ID: 932214574

View in Genome Browser
Species Human (GRCh38)
Location 2:69958574-69958596
Sequence GAGGGTAAAGAGTCTGTAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 171}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932214574_932214578 -1 Left 932214574 2:69958574-69958596 CCACTTACAGACTCTTTACCCTC 0: 1
1: 0
2: 0
3: 10
4: 171
Right 932214578 2:69958596-69958618 CCCTCCTTCTACCCAGCACGTGG 0: 1
1: 0
2: 0
3: 15
4: 182
932214574_932214581 3 Left 932214574 2:69958574-69958596 CCACTTACAGACTCTTTACCCTC 0: 1
1: 0
2: 0
3: 10
4: 171
Right 932214581 2:69958600-69958622 CCTTCTACCCAGCACGTGGCTGG 0: 1
1: 0
2: 0
3: 15
4: 123
932214574_932214585 13 Left 932214574 2:69958574-69958596 CCACTTACAGACTCTTTACCCTC 0: 1
1: 0
2: 0
3: 10
4: 171
Right 932214585 2:69958610-69958632 AGCACGTGGCTGGGATCCAAAGG 0: 1
1: 0
2: 0
3: 12
4: 111
932214574_932214582 4 Left 932214574 2:69958574-69958596 CCACTTACAGACTCTTTACCCTC 0: 1
1: 0
2: 0
3: 10
4: 171
Right 932214582 2:69958601-69958623 CTTCTACCCAGCACGTGGCTGGG 0: 1
1: 0
2: 0
3: 15
4: 194
932214574_932214587 22 Left 932214574 2:69958574-69958596 CCACTTACAGACTCTTTACCCTC 0: 1
1: 0
2: 0
3: 10
4: 171
Right 932214587 2:69958619-69958641 CTGGGATCCAAAGGACCTGGAGG 0: 1
1: 0
2: 1
3: 21
4: 204
932214574_932214586 19 Left 932214574 2:69958574-69958596 CCACTTACAGACTCTTTACCCTC 0: 1
1: 0
2: 0
3: 10
4: 171
Right 932214586 2:69958616-69958638 TGGCTGGGATCCAAAGGACCTGG 0: 1
1: 0
2: 1
3: 24
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932214574 Original CRISPR GAGGGTAAAGAGTCTGTAAG TGG (reversed) Intergenic
900195704 1:1374595-1374617 GAGGGGAAAGAGTGTGTGTGTGG + Intronic
903596880 1:24502276-24502298 GAGGGGAAGGAGTGGGTAAGGGG + Intergenic
903828145 1:26159675-26159697 GTGGGGAAGGAGTCTGTGAGAGG - Intronic
904774904 1:32900814-32900836 GAGAGTGGAGAGTATGTAAGTGG + Intronic
906780261 1:48567075-48567097 GAAGGTAAACAGACAGTAAGTGG - Intronic
907071467 1:51539465-51539487 GAGGGTAAAGAATAGGTGAGGGG - Intergenic
909714252 1:78688613-78688635 GAGGGTACAGTTTCTGAAAGAGG - Intergenic
910353230 1:86324017-86324039 GAGGGTTAGGAATCTGAAAGGGG + Intergenic
912704267 1:111900227-111900249 GGAGGTAAAGAGTCTTGAAGTGG - Intronic
913413991 1:118584563-118584585 CAGGGTCTGGAGTCTGTAAGGGG - Intergenic
916363465 1:163997515-163997537 GATGGTAAAGAATTTGTAAGGGG + Intergenic
916545460 1:165799970-165799992 GAGGTCAAAGCGTCAGTAAGTGG + Intronic
916693125 1:167210134-167210156 GAGGTTAAACAGTCAGTGAGAGG + Intergenic
918169706 1:181985047-181985069 GAGGAAAATGAGGCTGTAAGAGG - Intergenic
919796227 1:201322988-201323010 GAGGATAAAGAGCCGGTCAGGGG - Intronic
921912531 1:220565646-220565668 CAGGCTAAAGACTCTGTAGGAGG + Intronic
923349884 1:233093670-233093692 GAGGGTAAAGATCCTGTCAGTGG + Intronic
1063401117 10:5746857-5746879 GATGGTAGAGAGACTGGAAGGGG - Exonic
1064123370 10:12638447-12638469 GAGGGAAAAGCCTCTGTAAAAGG - Intronic
1065434855 10:25695382-25695404 GAGGGTAGAGAGTTTGCAATTGG - Intergenic
1066155296 10:32670109-32670131 GACAGTAAAGGGTCTCTAAGAGG - Intronic
1067839076 10:49661835-49661857 GAGGGTGAGGTGTCTGGAAGTGG - Intronic
1069689528 10:70340792-70340814 GAGGGCAAGGAGGCTGGAAGGGG - Intronic
1069782782 10:70967331-70967353 GAGGGTGGAGGGTCTGTCAGGGG + Intergenic
1069869368 10:71523868-71523890 CAGGGGAAAGAATCTTTAAGGGG - Intronic
1070665706 10:78342009-78342031 GAGGGTAAAGGGGCTGAATGTGG + Intergenic
1073484817 10:103810008-103810030 GAGGGTAATGAGTAGGTGAGAGG + Intronic
1073736793 10:106357191-106357213 GAGGCTACAGAGCCAGTAAGAGG - Intergenic
1077775231 11:5263483-5263505 GATGTCAAAGAGTCTGAAAGAGG + Intronic
1078807693 11:14722762-14722784 GTGGGTCAAGAATCTGAAAGTGG - Intronic
1080586693 11:33689274-33689296 GCGGGTAAAGAGGCAGGAAGAGG - Intergenic
1081338534 11:41898860-41898882 GAGGAAAAAGAATCTGAAAGAGG + Intergenic
1081365563 11:42230826-42230848 GTGGGTAAGGGGTCTGTGAGAGG + Intergenic
1091557300 12:1583898-1583920 GAAGGTAAATTGTGTGTAAGAGG + Intronic
1091672785 12:2464980-2465002 AAGGGTACAGAGTCAGTAAGTGG - Intronic
1091877276 12:3946063-3946085 GAGGAAAAAGAGGCTGTAAATGG - Intergenic
1095250075 12:39968696-39968718 GAGAGTAAAGTGTCAGTAATGGG - Intronic
1096986322 12:55760874-55760896 TAGGGTAAAGAAACAGTAAGAGG + Intronic
1098204772 12:68096843-68096865 GAGAGAAAAGAGTATGTAACAGG - Intergenic
1099659131 12:85533139-85533161 CATGGTAACGAGTTTGTAAGAGG + Intergenic
1099953508 12:89329590-89329612 GAGGGTAGCGAGTCTGAAAGAGG + Intergenic
1103072897 12:117959552-117959574 CAGGGTAAACAGACTGTAGGAGG - Intronic
1106505280 13:30365866-30365888 GTGGGCAAAGTGTCTGTCAGAGG - Intergenic
1107339729 13:39393447-39393469 GAGGGGAAGGAGGCTGTTAGGGG + Intronic
1107758793 13:43653905-43653927 GGGAGTAAAGATTCTGTTAGTGG - Intronic
1108269509 13:48745867-48745889 GAGGGTGAAGGGTCTGTGAAAGG + Intergenic
1115585888 14:34812657-34812679 GAATGTAAAGAGGATGTAAGTGG + Intronic
1116620475 14:47196810-47196832 GAGGGTAGAGAGTGGGGAAGAGG - Intronic
1116785771 14:49287172-49287194 GAGGATAAAGAGTATTTGAGTGG - Intergenic
1117696071 14:58364160-58364182 GATGAACAAGAGTCTGTAAGAGG - Exonic
1120758067 14:88262739-88262761 GTGGGTGAAGAGGCTGTCAGTGG - Intronic
1121158665 14:91713044-91713066 GATAGTAAAGAGTTTGTAAAGGG + Intronic
1121333150 14:93060491-93060513 GAGGGTACACAGTCTGGAACAGG + Intronic
1124914797 15:33959446-33959468 GAGGTTAAAGAGGCATTAAGGGG - Intronic
1125471670 15:40010464-40010486 GCGGGTACAGAGACTGGAAGGGG + Intronic
1126232384 15:46342260-46342282 GGGGATAAAGAATGTGTAAGAGG - Intergenic
1126244089 15:46483358-46483380 GAAGGTAAGGAGTCTTTGAGAGG + Intergenic
1126918018 15:53487442-53487464 GTAGGTAAAGAGACTGTGAGAGG - Intergenic
1126970490 15:54105755-54105777 GAAAGTGAAGAGTATGTAAGTGG + Intronic
1127658621 15:61079092-61079114 GATGGTAATAAGTCTGTAATTGG - Intronic
1127978427 15:64016189-64016211 GTGGGCAGAGAATCTGTAAGAGG - Intronic
1128148567 15:65346811-65346833 GAGGGAAAAGAGGCTCAAAGAGG - Intronic
1130655692 15:85790760-85790782 TTGGGTACAGAGTCTGTATGAGG - Intronic
1133681811 16:8126878-8126900 GGGGTAAAGGAGTCTGTAAGTGG + Intergenic
1134323929 16:13189528-13189550 GAGGGTAAAAAGTTTTTACGTGG + Intronic
1134817229 16:17215708-17215730 GAGGGAAAAGTGTCCCTAAGTGG + Intronic
1135206709 16:20491311-20491333 GTGGGTAAAGAATATGGAAGGGG + Intergenic
1135212176 16:20532321-20532343 GTGGGTAAAGAATATGGAAGGGG - Intergenic
1136098372 16:27974970-27974992 GAGGGAAAGGAGCCTGGAAGAGG + Intronic
1137961206 16:52883935-52883957 GGGGATAAAGAGTGTGGAAGAGG + Intergenic
1139329354 16:66175494-66175516 GAGGAAATAGAGACTGTAAGAGG + Intergenic
1140545967 16:75809526-75809548 GAGGGTATAAAGTGTGTAAGCGG + Intergenic
1140663258 16:77207852-77207874 GGGGGTAAAGAGTATGGAGGGGG - Intronic
1143948027 17:10611228-10611250 GAGGGTGAAGAATCTTCAAGGGG + Intergenic
1144529001 17:16017864-16017886 GAGGGAAAAGTTCCTGTAAGAGG - Intronic
1147357592 17:39909971-39909993 GAGGGAAAAGAGTCAGTGGGAGG - Intronic
1148015666 17:44520252-44520274 GACAGGAAAGAGTCTGTAAGGGG + Intergenic
1150873463 17:68942212-68942234 GATGGAACAGAGTCTGCAAGTGG - Intronic
1152089438 17:78238645-78238667 GAGGGTACAGAGTGTGTGGGGGG + Intronic
1154078822 18:11234319-11234341 AAGGGGAATGAGTCTGAAAGTGG - Intergenic
1156746562 18:40398729-40398751 GAGGGTAAAAAGTCTGAAATGGG - Intergenic
1157197161 18:45628964-45628986 GAGGGAAAGGAGACTGGAAGGGG + Intronic
1157460747 18:47890999-47891021 GATGTTTAAAAGTCTGTAAGAGG + Intronic
1159789522 18:72760602-72760624 AAGGGCAAAGAGTGTGAAAGAGG - Intronic
1160184149 18:76661640-76661662 AAAGGTGAAGAGTCTGTAACTGG - Intergenic
1161412189 19:4123113-4123135 GAGGGTGAAGAGTTCCTAAGAGG - Intronic
1162099284 19:8330110-8330132 GAGGGTGAAAGGTCTGGAAGTGG + Intronic
925649647 2:6076196-6076218 GAGAGCAAAGACACTGTAAGGGG + Intergenic
926944320 2:18170509-18170531 GTGGGTAAAGAGGCTGTTACAGG + Intronic
927974028 2:27324371-27324393 GAGGGTAAGCTGTCTGTAAAAGG - Intronic
928263727 2:29790997-29791019 GAGGTCACAGAGACTGTAAGAGG - Intronic
928525876 2:32139897-32139919 GAGGTGAAAGAATCTGTATGAGG + Intronic
929016557 2:37503234-37503256 GTGGGTAAAGAGACAGGAAGAGG + Intergenic
929617086 2:43319744-43319766 CAGGGTAATGAGTCTGCAACTGG - Intronic
931027028 2:58122185-58122207 GATAGTGAAGAGACTGTAAGAGG - Intronic
931566030 2:63616388-63616410 GAGGGTAAAGGGGCTGAAAATGG + Intronic
932072853 2:68637922-68637944 GAGGGTTAAGAATCTGGGAGTGG - Intergenic
932214574 2:69958574-69958596 GAGGGTAAAGAGTCTGTAAGTGG - Intergenic
935420216 2:102859871-102859893 GTGGGTCAAGAGTGTGGAAGTGG + Intergenic
937431931 2:121846191-121846213 GAGGGCAGAGAGGCTGTAGGAGG - Intergenic
939909556 2:147963188-147963210 TAGGGTAATGTGTCTGTTAGGGG - Intronic
944871051 2:203912011-203912033 GATGGTAAAGAGGGTTTAAGTGG - Intergenic
945055944 2:205869013-205869035 GTGGGTAATGAGTCAGAAAGAGG + Intergenic
945518957 2:210799410-210799432 AAGGGTACAGAGAATGTAAGAGG - Intergenic
947678427 2:232006975-232006997 GAGATTAAAGAGTGTGTAATGGG + Intronic
1168763663 20:367279-367301 GAGGGCAAGGAGTGTGTAGGAGG - Intronic
1171008456 20:21491563-21491585 GAGGATAAAGAGTCTCTATTTGG - Intergenic
1172775530 20:37404551-37404573 GAGGGAAAAGAGTGCCTAAGCGG + Exonic
1173322720 20:42002907-42002929 GAGGGAAATGAGGCTGAAAGAGG - Intergenic
1173342746 20:42167626-42167648 GAGAGGAGAGAGTCTGGAAGAGG + Intronic
1173912166 20:46678512-46678534 GATGGTAAAGAGTCAATGAGAGG - Intronic
1174897315 20:54463604-54463626 GAGGCTACAAAGTATGTAAGGGG + Intergenic
1174967732 20:55237936-55237958 GAGTGGAAAGAGTCTGGCAGAGG + Intergenic
1177984158 21:27952392-27952414 TATGGTAAAGAGTCTGAAATAGG - Intergenic
1178187059 21:30234780-30234802 GAGGCTACACAGTTTGTAAGTGG + Intergenic
1181379037 22:22484823-22484845 GAGAGTAAAGTGCCTTTAAGAGG + Exonic
950234680 3:11308458-11308480 GAGAGTAAAGAGCCTGGGAGGGG - Intronic
950941129 3:16892848-16892870 AAGGTTAGAGAGGCTGTAAGAGG + Intronic
956609808 3:71111213-71111235 GAGGGGACAGAATCTATAAGCGG - Intronic
956797299 3:72728533-72728555 GAGGGTTCAGAGTCTGTTGGTGG - Intergenic
957582485 3:82092316-82092338 GAAGATTAAGAGGCTGTAAGAGG + Intergenic
962393370 3:134992676-134992698 GAGTGTGTAGAGTCTGAAAGGGG + Intronic
963291373 3:143493294-143493316 CAGGGTAAATAGTGTGTAAATGG - Intronic
970282750 4:14476190-14476212 GATGGTAAAGATTCAATAAGTGG + Intergenic
970657811 4:18250948-18250970 GAGGCCAGAGAGGCTGTAAGTGG + Intergenic
970741386 4:19241960-19241982 GGTGGTTAAGAGTCTGGAAGGGG + Intergenic
972942597 4:44215092-44215114 GTGGGTAAGGAGTCAGAAAGTGG - Intronic
974029690 4:56765078-56765100 GAGGATAAAGAGTCTGTGGTTGG + Intergenic
974562460 4:63539727-63539749 GAGGGTAGAAAATATGTAAGAGG - Intergenic
978560305 4:110026721-110026743 GAGGTAAAAGTGTTTGTAAGTGG + Intergenic
978839721 4:113196816-113196838 GAGGGAAAAGAAGCTTTAAGTGG - Intronic
979131769 4:117056068-117056090 GAGTGTAAAGGGTGTGTAGGTGG - Intergenic
984144973 4:176049207-176049229 TAGGGTTAAGAGTCTATAAAGGG + Intergenic
984925779 4:184805581-184805603 GAGGGCAATGAGCCTGGAAGTGG + Intronic
986469791 5:8062138-8062160 GAGGGCACAGATTCTGAAAGAGG + Intergenic
986982961 5:13470018-13470040 CAGGGTAAAGAGACTGAAACAGG + Intergenic
990332768 5:54743982-54744004 CATAGTAAAGAGCCTGTAAGAGG - Intergenic
992791873 5:80220947-80220969 GAGGGAAAAGAGCCAGGAAGTGG + Intronic
993466115 5:88249199-88249221 GAGGGAAAAGGGTCAATAAGAGG + Intronic
999246423 5:150157420-150157442 GAGGGCTAGGAGTCTGTAACTGG - Intergenic
1000200612 5:159006432-159006454 GATGGTAAAGAGGCTATAGGGGG + Intronic
1008929820 6:56927009-56927031 GAGGGAAAAGAGCAGGTAAGAGG + Intronic
1012736138 6:102947232-102947254 GAGGGAAAAGAGTTTGTAGTAGG + Intergenic
1013941843 6:115673371-115673393 AAAGATAAAGAGGCTGTAAGTGG + Intergenic
1015412983 6:132915393-132915415 GAGGGTAGAGAGTTTGTCAAGGG - Intergenic
1016913009 6:149217226-149217248 GAAGGTCAATAGTTTGTAAGTGG - Intergenic
1017376555 6:153776426-153776448 GAGGGAAGAAAGACTGTAAGTGG - Intergenic
1019548292 7:1589143-1589165 GTGGGTCAAGAGTTTGGAAGTGG + Intergenic
1022670087 7:32447394-32447416 GAGGGGAAAGACTCTGTGGGAGG + Intergenic
1022817475 7:33927662-33927684 GGGGGTAAAGAGTTTAAAAGTGG - Intronic
1023431130 7:40092295-40092317 AAGGGCAAATATTCTGTAAGTGG - Intronic
1023624550 7:42103030-42103052 GAGGGTAGAGAATCCGGAAGCGG + Intronic
1023637434 7:42226823-42226845 GTGGGTGAAGAGTCAGTGAGCGG + Intronic
1024113664 7:46172455-46172477 GAGAGTAAAGAGTCAGGGAGTGG + Intergenic
1024630294 7:51241757-51241779 GAGGATCATGAGTCTGGAAGAGG - Intronic
1024797626 7:53037005-53037027 AAGGGCAAAGATTCTGTATGGGG + Intergenic
1026628741 7:72019316-72019338 AAGGGTAAAGATTCTGTAATTGG - Intronic
1028025994 7:85840813-85840835 GAGGCCAATGAGTGTGTAAGGGG - Intergenic
1029245520 7:99196828-99196850 GAGTCAAAATAGTCTGTAAGTGG - Intronic
1029800439 7:102941312-102941334 CAGGGTAAAGAATCTGGAAGTGG + Intronic
1030741943 7:113120057-113120079 AAGTTTAAAGAGTCTGTAAGTGG + Intergenic
1031332957 7:120488634-120488656 GAGGTTAAATAGCCTGTGAGGGG - Intronic
1032210952 7:129913640-129913662 AAGGGTAAAGAGCCTTTAACTGG + Intronic
1033935503 7:146580010-146580032 GAGGGGAAAGAGTGTGTTTGGGG - Intronic
1034265376 7:149778092-149778114 GAGGGTGGAGAGACTGTCAGAGG - Intergenic
1039573321 8:38603949-38603971 GAGAGTCAAGAGACTGGAAGTGG + Intergenic
1039650236 8:39333584-39333606 GATTGTAAAGAATTTGTAAGGGG + Intergenic
1043953140 8:86331655-86331677 AAGGGTAAAGAGAGAGTAAGAGG + Intergenic
1044879066 8:96703816-96703838 AAAGGTCAAGAATCTGTAAGGGG + Intronic
1047446074 8:124920865-124920887 AAAGGTAAAGAGTATGTAACAGG - Intergenic
1048293287 8:133196623-133196645 GAGGGCACAAAGCCTGTAAGTGG - Intronic
1060509476 9:124221664-124221686 TAGGATAAAAACTCTGTAAGTGG - Intergenic
1061389633 9:130310303-130310325 GAGGATCAAGAATCTGAAAGTGG + Intronic
1062076911 9:134594601-134594623 GAGGGTGAAGTGGCTGGAAGAGG - Intergenic
1186752847 X:12639789-12639811 GAGGGTGAAGAGGCTCAAAGAGG + Intronic
1189593711 X:42542542-42542564 GAGGCAAAAGAGGCTGGAAGGGG + Intergenic
1190150362 X:47941653-47941675 GTGGGTTAAGAATCTGTGAGTGG - Intronic
1190476020 X:50828151-50828173 GAGGGTAAAGTGTGAGTCAGAGG - Intergenic
1192171395 X:68857456-68857478 GAGGGTAGAGAGTGTGTTGGTGG + Intergenic
1192765644 X:74137322-74137344 GAGGCTAAAGAGTCTATGGGTGG - Intergenic
1195100854 X:101552602-101552624 GAGGTTGGAGAGTCTTTAAGCGG + Intronic
1197241234 X:124125271-124125293 GAGGGTAAAGAGGCTGGGGGGGG - Intronic