ID: 932215850

View in Genome Browser
Species Human (GRCh38)
Location 2:69965573-69965595
Sequence CTGTGTTCTGGGAAGTCGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932215850_932215856 28 Left 932215850 2:69965573-69965595 CCTGACGACTTCCCAGAACACAG No data
Right 932215856 2:69965624-69965646 TGACCACAGCGAGATACATTTGG No data
932215850_932215854 -7 Left 932215850 2:69965573-69965595 CCTGACGACTTCCCAGAACACAG No data
Right 932215854 2:69965589-69965611 AACACAGTGGCAGCTTGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932215850 Original CRISPR CTGTGTTCTGGGAAGTCGTC AGG (reversed) Intergenic
No off target data available for this crispr