ID: 932217838

View in Genome Browser
Species Human (GRCh38)
Location 2:69978267-69978289
Sequence CCTCCAGGGGAGTCTCCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932217823_932217838 23 Left 932217823 2:69978221-69978243 CCCAGGGGGCTCTGTACTCTCCC No data
Right 932217838 2:69978267-69978289 CCTCCAGGGGAGTCTCCTTGGGG No data
932217826_932217838 2 Left 932217826 2:69978242-69978264 CCAACACTCTTTCCACCCCTCCA No data
Right 932217838 2:69978267-69978289 CCTCCAGGGGAGTCTCCTTGGGG No data
932217825_932217838 3 Left 932217825 2:69978241-69978263 CCCAACACTCTTTCCACCCCTCC No data
Right 932217838 2:69978267-69978289 CCTCCAGGGGAGTCTCCTTGGGG No data
932217824_932217838 22 Left 932217824 2:69978222-69978244 CCAGGGGGCTCTGTACTCTCCCA No data
Right 932217838 2:69978267-69978289 CCTCCAGGGGAGTCTCCTTGGGG No data
932217822_932217838 24 Left 932217822 2:69978220-69978242 CCCCAGGGGGCTCTGTACTCTCC No data
Right 932217838 2:69978267-69978289 CCTCCAGGGGAGTCTCCTTGGGG No data
932217829_932217838 -10 Left 932217829 2:69978254-69978276 CCACCCCTCCAAGCCTCCAGGGG No data
Right 932217838 2:69978267-69978289 CCTCCAGGGGAGTCTCCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932217838 Original CRISPR CCTCCAGGGGAGTCTCCTTG GGG Intergenic