ID: 932218702

View in Genome Browser
Species Human (GRCh38)
Location 2:69983819-69983841
Sequence CAGTACCATGATGGAACTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932218702_932218711 -4 Left 932218702 2:69983819-69983841 CCCCCAGTTCCATCATGGTACTG No data
Right 932218711 2:69983838-69983860 ACTGGTGGGGCTGTCAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932218702 Original CRISPR CAGTACCATGATGGAACTGG GGG (reversed) Intergenic
No off target data available for this crispr