ID: 932232469

View in Genome Browser
Species Human (GRCh38)
Location 2:70094201-70094223
Sequence ATGGCCTAACAGCTGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932232469_932232476 5 Left 932232469 2:70094201-70094223 CCTGCCTCCAGCTGTTAGGCCAT No data
Right 932232476 2:70094229-70094251 CTGCCATAGTTGGGAAGAGCTGG No data
932232469_932232478 11 Left 932232469 2:70094201-70094223 CCTGCCTCCAGCTGTTAGGCCAT No data
Right 932232478 2:70094235-70094257 TAGTTGGGAAGAGCTGGAACAGG No data
932232469_932232474 -4 Left 932232469 2:70094201-70094223 CCTGCCTCCAGCTGTTAGGCCAT No data
Right 932232474 2:70094220-70094242 CCATAGCCACTGCCATAGTTGGG No data
932232469_932232472 -5 Left 932232469 2:70094201-70094223 CCTGCCTCCAGCTGTTAGGCCAT No data
Right 932232472 2:70094219-70094241 GCCATAGCCACTGCCATAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932232469 Original CRISPR ATGGCCTAACAGCTGGAGGC AGG (reversed) Intergenic
No off target data available for this crispr