ID: 932232472

View in Genome Browser
Species Human (GRCh38)
Location 2:70094219-70094241
Sequence GCCATAGCCACTGCCATAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932232469_932232472 -5 Left 932232469 2:70094201-70094223 CCTGCCTCCAGCTGTTAGGCCAT No data
Right 932232472 2:70094219-70094241 GCCATAGCCACTGCCATAGTTGG No data
932232467_932232472 1 Left 932232467 2:70094195-70094217 CCTGTTCCTGCCTCCAGCTGTTA No data
Right 932232472 2:70094219-70094241 GCCATAGCCACTGCCATAGTTGG No data
932232466_932232472 2 Left 932232466 2:70094194-70094216 CCCTGTTCCTGCCTCCAGCTGTT No data
Right 932232472 2:70094219-70094241 GCCATAGCCACTGCCATAGTTGG No data
932232470_932232472 -9 Left 932232470 2:70094205-70094227 CCTCCAGCTGTTAGGCCATAGCC No data
Right 932232472 2:70094219-70094241 GCCATAGCCACTGCCATAGTTGG No data
932232465_932232472 30 Left 932232465 2:70094166-70094188 CCTATGCAGTTGCTGATTCTTGT No data
Right 932232472 2:70094219-70094241 GCCATAGCCACTGCCATAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932232472 Original CRISPR GCCATAGCCACTGCCATAGT TGG Intergenic
No off target data available for this crispr