ID: 932232474

View in Genome Browser
Species Human (GRCh38)
Location 2:70094220-70094242
Sequence CCATAGCCACTGCCATAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932232470_932232474 -8 Left 932232470 2:70094205-70094227 CCTCCAGCTGTTAGGCCATAGCC No data
Right 932232474 2:70094220-70094242 CCATAGCCACTGCCATAGTTGGG No data
932232469_932232474 -4 Left 932232469 2:70094201-70094223 CCTGCCTCCAGCTGTTAGGCCAT No data
Right 932232474 2:70094220-70094242 CCATAGCCACTGCCATAGTTGGG No data
932232466_932232474 3 Left 932232466 2:70094194-70094216 CCCTGTTCCTGCCTCCAGCTGTT No data
Right 932232474 2:70094220-70094242 CCATAGCCACTGCCATAGTTGGG No data
932232467_932232474 2 Left 932232467 2:70094195-70094217 CCTGTTCCTGCCTCCAGCTGTTA No data
Right 932232474 2:70094220-70094242 CCATAGCCACTGCCATAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932232474 Original CRISPR CCATAGCCACTGCCATAGTT GGG Intergenic
No off target data available for this crispr