ID: 932232476

View in Genome Browser
Species Human (GRCh38)
Location 2:70094229-70094251
Sequence CTGCCATAGTTGGGAAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932232467_932232476 11 Left 932232467 2:70094195-70094217 CCTGTTCCTGCCTCCAGCTGTTA No data
Right 932232476 2:70094229-70094251 CTGCCATAGTTGGGAAGAGCTGG No data
932232466_932232476 12 Left 932232466 2:70094194-70094216 CCCTGTTCCTGCCTCCAGCTGTT No data
Right 932232476 2:70094229-70094251 CTGCCATAGTTGGGAAGAGCTGG No data
932232469_932232476 5 Left 932232469 2:70094201-70094223 CCTGCCTCCAGCTGTTAGGCCAT No data
Right 932232476 2:70094229-70094251 CTGCCATAGTTGGGAAGAGCTGG No data
932232470_932232476 1 Left 932232470 2:70094205-70094227 CCTCCAGCTGTTAGGCCATAGCC No data
Right 932232476 2:70094229-70094251 CTGCCATAGTTGGGAAGAGCTGG No data
932232471_932232476 -2 Left 932232471 2:70094208-70094230 CCAGCTGTTAGGCCATAGCCACT No data
Right 932232476 2:70094229-70094251 CTGCCATAGTTGGGAAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932232476 Original CRISPR CTGCCATAGTTGGGAAGAGC TGG Intergenic
No off target data available for this crispr