ID: 932232478

View in Genome Browser
Species Human (GRCh38)
Location 2:70094235-70094257
Sequence TAGTTGGGAAGAGCTGGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932232466_932232478 18 Left 932232466 2:70094194-70094216 CCCTGTTCCTGCCTCCAGCTGTT No data
Right 932232478 2:70094235-70094257 TAGTTGGGAAGAGCTGGAACAGG No data
932232471_932232478 4 Left 932232471 2:70094208-70094230 CCAGCTGTTAGGCCATAGCCACT No data
Right 932232478 2:70094235-70094257 TAGTTGGGAAGAGCTGGAACAGG No data
932232470_932232478 7 Left 932232470 2:70094205-70094227 CCTCCAGCTGTTAGGCCATAGCC No data
Right 932232478 2:70094235-70094257 TAGTTGGGAAGAGCTGGAACAGG No data
932232473_932232478 -8 Left 932232473 2:70094220-70094242 CCATAGCCACTGCCATAGTTGGG No data
Right 932232478 2:70094235-70094257 TAGTTGGGAAGAGCTGGAACAGG No data
932232467_932232478 17 Left 932232467 2:70094195-70094217 CCTGTTCCTGCCTCCAGCTGTTA No data
Right 932232478 2:70094235-70094257 TAGTTGGGAAGAGCTGGAACAGG No data
932232469_932232478 11 Left 932232469 2:70094201-70094223 CCTGCCTCCAGCTGTTAGGCCAT No data
Right 932232478 2:70094235-70094257 TAGTTGGGAAGAGCTGGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932232478 Original CRISPR TAGTTGGGAAGAGCTGGAAC AGG Intergenic
No off target data available for this crispr