ID: 932236558

View in Genome Browser
Species Human (GRCh38)
Location 2:70125234-70125256
Sequence CAGGGGTAGTGGAGGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 734
Summary {0: 1, 1: 0, 2: 5, 3: 62, 4: 666}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932236543_932236558 26 Left 932236543 2:70125185-70125207 CCGTTCTTTGTTAAATAAAGACG 0: 1
1: 0
2: 0
3: 22
4: 257
Right 932236558 2:70125234-70125256 CAGGGGTAGTGGAGGGCAGAGGG 0: 1
1: 0
2: 5
3: 62
4: 666

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932236558 Original CRISPR CAGGGGTAGTGGAGGGCAGA GGG Intergenic
900407794 1:2500083-2500105 GGGGGGTAGTAGAGGGGAGAGGG - Intronic
900419139 1:2548032-2548054 CAGGGGGAGGGGAGGGAGGAGGG + Intergenic
900490973 1:2949006-2949028 CAGGTGCCGGGGAGGGCAGACGG + Intergenic
900554864 1:3275406-3275428 GCGGGGTAGGGGTGGGCAGAGGG - Intronic
900657071 1:3763647-3763669 CAGGGGCAGTGAGGGACAGAAGG - Intronic
900666716 1:3820503-3820525 CTGGGGTGGAGGAAGGCAGATGG + Intronic
900762597 1:4482999-4483021 GAGGGGAAGTAGTGGGCAGAGGG - Intergenic
900940217 1:5793614-5793636 CAGTGGTGGTGGTGGCCAGATGG + Intergenic
900993141 1:6107017-6107039 GAGGGATAATGGAGGGAAGATGG + Intronic
901209488 1:7516396-7516418 GAGGGGCCGTGGAGGGCAGCTGG + Intronic
902581852 1:17412898-17412920 CGGGGGTACAGGAGGGGAGAGGG - Intronic
902776084 1:18675929-18675951 CAGGGATGCTGGTGGGCAGATGG - Intronic
902790673 1:18765754-18765776 CAGGGGAAGAGCAGGGAAGAAGG + Intergenic
902951330 1:19885133-19885155 GACGGGTAGTGTAGGGCACAAGG + Intronic
902972646 1:20065425-20065447 CAGGGGTTTGGGAGGACAGAGGG - Intronic
903113372 1:21157478-21157500 CAGGTGTAGTGGTGAGCAGGAGG - Intronic
903140271 1:21335075-21335097 CAGAGGCAGTGGAGGGTGGAGGG - Intronic
903271034 1:22188449-22188471 CAGGGTTAGGGGCAGGCAGAGGG - Intergenic
903341095 1:22654848-22654870 CAAGGGTAGTGGTAGGCACATGG - Intronic
903353338 1:22731231-22731253 CGGGGGGAATGGAGGGCAGAGGG + Intronic
903756360 1:25664133-25664155 CAGAGCGTGTGGAGGGCAGATGG - Intronic
903789997 1:25886243-25886265 CAGTGGGAGGGAAGGGCAGAGGG + Intronic
903811242 1:26036103-26036125 CCTTGGTAGTGCAGGGCAGACGG - Exonic
904544448 1:31257488-31257510 CAGTCATAGTGGAAGGCAGAGGG - Intergenic
904573953 1:31490124-31490146 CAAGGGTAATGGAGGGCTGGTGG - Intergenic
904912983 1:33949334-33949356 CAGTGGCTGGGGAGGGCAGATGG + Intronic
905731042 1:40299773-40299795 ATGGGCTAGTGGAGGGCAGTGGG + Intergenic
906010916 1:42524696-42524718 CAGGGGTGGAGGAGAGGAGATGG + Intronic
906063614 1:42964085-42964107 CAGGGGTGGAGGGGGGTAGAGGG - Intergenic
906115233 1:43352321-43352343 CAGGGTTGGTGGTGGGCACAGGG - Intronic
906326594 1:44850041-44850063 CAGGGGTGGTGGAGGGAAGGTGG + Intergenic
907222548 1:52917557-52917579 CATGGGTAGAGGAGGGAGGATGG + Intronic
907293442 1:53433479-53433501 AAGGAGGAATGGAGGGCAGAAGG - Intergenic
907338489 1:53716281-53716303 CAGGGGGAGAGGGAGGCAGAGGG + Intronic
907998609 1:59657829-59657851 TAGGGATGGTGGAGGGCAGGTGG + Intronic
908444821 1:64190571-64190593 CGGGGGTAGTGAAAGGCATATGG - Intergenic
908703303 1:66924904-66924926 GAGGCGGAGGGGAGGGCAGAGGG + Intronic
909367863 1:74849225-74849247 GAAGGGTAGTGGAGGGCTGATGG - Intergenic
909384014 1:75035362-75035384 CAGGGGTAGTGGTGGCCACAGGG + Intergenic
910079785 1:83327972-83327994 AAGGGGTGGAGGAGGGCTGAAGG - Intergenic
912354551 1:109043888-109043910 AAAGTGTAGTGGAGGGCAAAGGG + Intergenic
912813416 1:112810667-112810689 AAGGGGGAATGGAGGGCGGAAGG - Intergenic
913248427 1:116890898-116890920 CAGGGGCTGGGGAGAGCAGAAGG - Intergenic
913480091 1:119280044-119280066 CAGGGGTTGTGGGGGGCCGGGGG - Intergenic
914821418 1:151107092-151107114 AATGGGGAGTGGAGGCCAGAGGG + Exonic
915535728 1:156534271-156534293 CAGAGGTAGGGCAGGACAGAGGG - Intronic
915602204 1:156929494-156929516 CAGAGGTGGTGGAGGGAAGAAGG + Intronic
916210525 1:162356416-162356438 CAGAGGCAGTGGAGGGCAGGAGG + Intronic
917136579 1:171793980-171794002 CTGGGGTAGTAGGGGGCAGATGG - Intronic
918612068 1:186504225-186504247 CAAGGGCAGTGGAGGGAGGAGGG + Intergenic
919798993 1:201339578-201339600 CTGGGGCAGTGGAGTGCAGTGGG - Intergenic
919799081 1:201341271-201341293 CAGGAATAGTGGAGACCAGAAGG - Intergenic
919930230 1:202216624-202216646 GAGAGGTAGTAGAGAGCAGAGGG + Intronic
920664440 1:207951179-207951201 AAGTGGTAGTGGAAGGTAGAGGG - Intergenic
921072152 1:211669867-211669889 GAGGGGTGATGGAGGGCGGACGG - Intronic
921307764 1:213814196-213814218 CAGGAGTATTGCAGAGCAGAAGG - Intergenic
921994519 1:221403572-221403594 GAAGGGTAGTGGGGGGCAGAAGG + Intergenic
922604542 1:226881336-226881358 CAGGAGGAGGGAAGGGCAGAAGG - Intronic
922866595 1:228866017-228866039 CAGGGATGGTGGGGGGCAGGGGG + Intergenic
922883904 1:229003491-229003513 CAGGGGGAGGGGAGGGAGGAAGG + Intergenic
923013029 1:230104178-230104200 CTGGGGTGGTGGGGGGCCGAGGG + Intronic
923017946 1:230141446-230141468 CAGGGGGAGGGGAGGGGAGAAGG - Intronic
923035900 1:230285011-230285033 CACTGGTGGTGGAAGGCAGAGGG + Intergenic
923237655 1:232049762-232049784 CAGAGGTTGTGGGGGGCAGGTGG + Intergenic
923373896 1:233340591-233340613 CAGGGGAAGGGGGAGGCAGATGG + Intronic
924552232 1:245089540-245089562 CAGATGTAGTGGAGAGGAGAGGG + Intronic
924845551 1:247766605-247766627 CAGGGGTAGGGAATGGAAGACGG + Intergenic
1063167510 10:3477178-3477200 CATGGGTAGAATAGGGCAGATGG + Intergenic
1064114791 10:12568383-12568405 GAGGGGAAGGGGAGGGGAGAAGG - Intronic
1064476229 10:15691688-15691710 CAGAGGCTGGGGAGGGCAGAAGG + Intronic
1065102588 10:22345576-22345598 CAGAGCTCGAGGAGGGCAGACGG + Exonic
1065177734 10:23095555-23095577 CAGGGGCAGAGACGGGCAGAGGG + Exonic
1065478101 10:26163123-26163145 TAGGGATATAGGAGGGCAGAAGG + Intronic
1065972684 10:30817906-30817928 CTGGGGTATTGGAGGGAAGCTGG + Intergenic
1066103514 10:32137900-32137922 AAGGGGAAATGGAGGGCGGAAGG + Intergenic
1066334525 10:34462900-34462922 AAGGGGGAGAGGAGGGGAGAGGG + Intronic
1066546016 10:36501548-36501570 CATGGGTAGTGAAGGGCATGAGG - Intergenic
1067209482 10:44247425-44247447 CAGGTTTATTGGAGGTCAGATGG + Intergenic
1067452205 10:46388688-46388710 CAAGGGGAATGGGGGGCAGAGGG + Intronic
1067561748 10:47309448-47309470 CAGAGGCAGTAGAGGGCAGGGGG + Intronic
1067585032 10:47471067-47471089 CAAGGGGAATGGGGGGCAGAGGG - Intronic
1067807600 10:49404078-49404100 GAGGTGTTGGGGAGGGCAGAGGG - Intergenic
1068866777 10:61903178-61903200 GCGGGGGAGGGGAGGGCAGAGGG + Intronic
1069198287 10:65581700-65581722 CAGCGCTAATGGAGGGCAAAGGG - Intergenic
1069345264 10:67462124-67462146 CTGGGGCAGTGGAAGCCAGAAGG - Intronic
1069613837 10:69793429-69793451 CAGTGGTGGGGGCGGGCAGAGGG + Intergenic
1069893303 10:71665326-71665348 CAGGGGTAGTGGGAGGCAGTGGG - Intronic
1070756107 10:78994193-78994215 GAGTGGCAGTGAAGGGCAGATGG + Intergenic
1071115195 10:82210461-82210483 AAGGAGAAGTGGAGGGCAGGGGG + Intronic
1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG + Intergenic
1071293002 10:84200925-84200947 CTGGGGATGTGGAGGGCTGAGGG - Intronic
1072207445 10:93216764-93216786 CAGGGGAAGTGCAGGGCTGTAGG - Intergenic
1072669582 10:97419548-97419570 AAGGGGCAGTGGAGGGTAAAAGG + Intronic
1072737507 10:97889106-97889128 CAGGGGCAGTGGAGGCGGGAGGG + Intronic
1073107342 10:101039682-101039704 CAGGGGCCTTGGTGGGCAGATGG + Exonic
1073327000 10:102648915-102648937 CTGGGGTAGGGGTGGGCAGCTGG - Intronic
1073435735 10:103514614-103514636 CAGGGCTGGTGGAGAACAGAGGG + Intronic
1074151037 10:110759994-110760016 CAGTGGTGGTGGGGGGCACAGGG + Intronic
1075719547 10:124576706-124576728 CGGGGGTACTGGGGGGCTGAGGG + Intronic
1076135138 10:128040484-128040506 CAGGGCGAGTGGAGGGTGGATGG + Intronic
1076157683 10:128216087-128216109 CAGGGCAGGTGGAGGGCAGAGGG + Intergenic
1077185783 11:1234766-1234788 CAGGGGGCGGGGAGGGCAGGGGG + Intronic
1077190129 11:1252532-1252554 CACGGGAGGTGGAGGGCAGGCGG - Intronic
1077395708 11:2320090-2320112 CAGTGCTAGTGGAGGGGAGTGGG + Intergenic
1077506328 11:2931461-2931483 CGGGGGTACTGGAGGCCAGGAGG + Intergenic
1078441563 11:11372633-11372655 CAGGGGCAGGGGAGAGCAGAAGG + Intronic
1078642375 11:13108638-13108660 CAGGGCTTGTGGAGGGAAGAGGG + Intergenic
1079361225 11:19771963-19771985 CAAGGCTGGTGGAGGGGAGACGG + Intronic
1080275765 11:30501951-30501973 CAGGGATGGAGAAGGGCAGAGGG + Intronic
1080614339 11:33932961-33932983 GAGAGGAAATGGAGGGCAGAGGG - Intergenic
1081617699 11:44600367-44600389 CATGGGCAGTGGTGGGCAGCAGG - Intronic
1081705250 11:45179124-45179146 TGGGGCTTGTGGAGGGCAGAGGG + Intronic
1081968314 11:47182759-47182781 TTGGGGCTGTGGAGGGCAGAGGG + Exonic
1082175616 11:49055668-49055690 CAGGGGGTGTGATGGGCAGAGGG - Intronic
1083594219 11:63911414-63911436 CAGGGGGGGAGGTGGGCAGAGGG - Exonic
1083611004 11:64004259-64004281 CTGGGGCAGTGGAGGGCACCAGG + Intronic
1083765600 11:64840066-64840088 CAGGGGTTGGGCAGGGCAGCGGG + Intronic
1083775163 11:64891102-64891124 CAGGGATAGGGGAGGGCCGGGGG - Intergenic
1084066690 11:66708314-66708336 CAGGGTTAGTGGAAGGGACAGGG + Intronic
1084104892 11:66975015-66975037 AAGGGGGAGGGGAGGGGAGAAGG + Intergenic
1084581726 11:70028444-70028466 TGGGGGTGGGGGAGGGCAGAAGG - Intergenic
1085351006 11:75797811-75797833 CAAGGGTGGGGGAGGGTAGAGGG + Intronic
1085503304 11:77041269-77041291 CTGGGGTAGTGGTGGGAAGAAGG - Exonic
1086754720 11:90545482-90545504 GAGAGATAGTGGAGGTCAGATGG - Intergenic
1086849024 11:91786569-91786591 CAGTGGTAATGCAGGGCAGATGG - Intergenic
1087370750 11:97280283-97280305 CAGTGGTGGTGGTGGCCAGAGGG + Intergenic
1087955564 11:104282785-104282807 CAGGGGTAATGGAGGGAATAAGG - Intergenic
1088740752 11:112765071-112765093 CTGGGCTAGTGCAGGGAAGAGGG + Intergenic
1088746278 11:112807642-112807664 CAGGGGAAGTGGAAGTTAGAGGG + Intergenic
1088769003 11:113014447-113014469 CAGGGGTGATGCTGGGCAGACGG - Intronic
1088817529 11:113431953-113431975 CAGGAGTAGAGGAGGGGACAGGG + Intronic
1089054557 11:115575052-115575074 GAGGGGTGGTGGAGAGAAGATGG + Intergenic
1089396666 11:118140641-118140663 AAGGGGAAGGGGAGGGAAGATGG - Intronic
1089487803 11:118860637-118860659 CAGGCGTAGTGGCGGGCACCTGG + Intergenic
1089538102 11:119173016-119173038 CAGGGGGTGTGGTGGGCAGACGG + Intronic
1089628316 11:119765953-119765975 CAGTGGTTGTGGGGGGCAGTGGG - Intergenic
1089641149 11:119848027-119848049 CAGGAGAAGGGGAGGGCAGAGGG - Intergenic
1090053505 11:123401658-123401680 CAGGGGTGGGGGAAGGAAGACGG + Intergenic
1090809434 11:130223690-130223712 CCGGGGGAGTGGGGGGCAGGAGG + Intergenic
1091005598 11:131950379-131950401 CAGAGATAGTGGAGGTAAGATGG - Intronic
1091744360 12:2981774-2981796 CAGGGGTGCTGGAGGGTAGTGGG + Intronic
1091775414 12:3181755-3181777 AAGAGGCAGTGCAGGGCAGAGGG - Intronic
1093961425 12:25277016-25277038 GGGGGGTATTGCAGGGCAGAGGG + Intergenic
1094093621 12:26678228-26678250 CAGGGATGGAGGAGGGAAGATGG - Intronic
1095542506 12:43327257-43327279 GAGGCCTATTGGAGGGCAGAGGG - Intergenic
1095752762 12:45729585-45729607 CAGGGGGAGAGGAGGGAAGGAGG - Intergenic
1095833549 12:46613063-46613085 CAGGGTTAGTAGAGGGAACATGG - Intergenic
1095952115 12:47787247-47787269 CAGGGGTAGAGGAAGGCAGCTGG - Intronic
1096153408 12:49328944-49328966 CAGGGGCAGGGGAGGGCATCAGG - Exonic
1096548320 12:52356357-52356379 CAGGGGTGAAGGAGGGCAGCCGG + Intergenic
1096551379 12:52375569-52375591 CAAGGGTTGTGGAGGGGGGAGGG - Intergenic
1096638522 12:52976260-52976282 TAGGTTTAGTGAAGGGCAGACGG - Intergenic
1097329171 12:58314609-58314631 CAGGGGGAGCTGAGGCCAGAGGG - Intergenic
1098038688 12:66333232-66333254 CAGGGGGTGTGGTGGGCAGGAGG + Intronic
1098427986 12:70387965-70387987 GAAGGGTAGTGGAGGGCTGTGGG - Intronic
1099751462 12:86779492-86779514 CTGGGGAAGTGGAGGTGAGAGGG + Intronic
1101736203 12:107465198-107465220 TCGGGGCACTGGAGGGCAGACGG - Intronic
1102555463 12:113723855-113723877 CAGGGGTTGGGGTGGCCAGAGGG + Intergenic
1102929188 12:116849552-116849574 CAGAGGTGGTGGAGGGCAAGAGG - Exonic
1103747138 12:123132674-123132696 CAGGGGTTGGGGAGGGGAGATGG - Intronic
1104041383 12:125133608-125133630 CAGGGGCAGTGGAGGGCACAGGG - Intronic
1104053296 12:125210631-125210653 CAGGGGAGGTGGAGGGGACAGGG + Intronic
1104623333 12:130334513-130334535 CCAGGGTAGTGGGGGGAAGAGGG + Intergenic
1104727856 12:131088653-131088675 CAGGGGTCGTGAGGGGCAGGAGG + Intronic
1104750234 12:131233695-131233717 CAAGGAGAGTGAAGGGCAGAGGG + Intergenic
1104782480 12:131430766-131430788 CAAGGAGAGTGAAGGGCAGAGGG - Intergenic
1105758996 13:23495781-23495803 CAGCAGTAGTGGAAGCCAGAAGG + Intergenic
1106144840 13:27041242-27041264 CAGGGAGACTGCAGGGCAGATGG - Intergenic
1106202284 13:27549472-27549494 CAGTGGTAGAGGCTGGCAGAGGG + Intronic
1106990198 13:35409729-35409751 CAGGGGAAAAGGAAGGCAGAAGG + Intronic
1107445260 13:40465068-40465090 CAGGGCTAGCACAGGGCAGAGGG - Intergenic
1107462401 13:40616739-40616761 CAAGGGGTGTGGAGGGAAGAAGG + Intronic
1108671044 13:52689065-52689087 CAGGGGGAGTGGGAGGCAAACGG + Intronic
1108807809 13:54181420-54181442 CAGGGCTACTTGTGGGCAGAGGG - Intergenic
1111171400 13:84530724-84530746 CAGGAGACGTGGAGGCCAGAGGG + Intergenic
1111450854 13:88413378-88413400 GAGGCCTACTGGAGGGCAGAGGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112229165 13:97570301-97570323 GAGGGGTGGTGGCGGGTAGAGGG + Intergenic
1112346662 13:98595832-98595854 CAGGAATGGTGGAGGGCTGAGGG + Intergenic
1113185460 13:107681890-107681912 TAGGGGTAGTGGAGAGGAGGAGG - Intronic
1113293431 13:108931296-108931318 CATTGCTATTGGAGGGCAGAAGG - Intronic
1113805940 13:113110078-113110100 CAGGGGTCGCGGGGGACAGAGGG + Intronic
1113847198 13:113399200-113399222 ACAGAGTAGTGGAGGGCAGAGGG + Intergenic
1113855703 13:113444342-113444364 GGGGGTTAGTGGAAGGCAGATGG + Intronic
1113929044 13:113956843-113956865 CAGGGCGAGAGGAGGGCAGGTGG + Intergenic
1114547016 14:23510542-23510564 TAGGGGTAGGGGATGGGAGAAGG - Intergenic
1114618228 14:24079802-24079824 CAGGCTAAGGGGAGGGCAGATGG - Intergenic
1114808155 14:25862126-25862148 CATTGGAAGTGGAGGGAAGATGG + Intergenic
1115343612 14:32318613-32318635 CAGTGGTTGTGGATGGCCGACGG + Intergenic
1116385844 14:44328847-44328869 CAGGGGACTTGGAGGGGAGAGGG - Intergenic
1116427334 14:44807018-44807040 GAGGGGAAGGGGAGGGAAGAAGG + Intergenic
1116430083 14:44836127-44836149 CCGGGGTGGGGGAGGGCAGAGGG - Intergenic
1116810227 14:49532820-49532842 GAAGGGTAGTGGAGGGCAGAGGG + Intergenic
1117186753 14:53247542-53247564 CAGGGCCAGGGGAGGGCAGGGGG - Intergenic
1118572493 14:67207571-67207593 CAGGGGCAGTGGAAAGAAGAAGG + Intronic
1119763915 14:77175998-77176020 CAGGGGTAAGAGAGGGCAGAGGG + Intronic
1120969060 14:90192287-90192309 CAGCGGGAGTGGGGGGCAGGAGG + Intergenic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1122503688 14:102218341-102218363 CAGGGGTCGTGGGGGTCAGAAGG + Intronic
1122516865 14:102314867-102314889 CAGGGGTGCAGGAGGGCAGAGGG + Intergenic
1122671897 14:103379080-103379102 CTGGGGTACTGGAAGCCAGAAGG + Intergenic
1122969731 14:105147670-105147692 CAGGGGGAGGGGCTGGCAGAAGG + Intronic
1122978818 14:105181923-105181945 CAGGGGGAGGGAAGGGCAGCTGG - Intergenic
1124022833 15:25939617-25939639 CAGGGGCAGTGGGGGTTAGATGG + Intergenic
1124029055 15:25992603-25992625 CATGGGCTGTGGAGGGTAGAGGG - Intergenic
1124345233 15:28917867-28917889 CAGGGGTACTGGGGGCCAGCTGG + Intronic
1125521157 15:40348483-40348505 CTGGGGTAGTGGAGGCCATGAGG - Intergenic
1126338187 15:47609866-47609888 CAGGGGCAGTGGCAGGCAGTGGG - Intronic
1126838350 15:52691057-52691079 CAGGGGGAGTGGAGAGTTGAGGG + Intronic
1126944140 15:53799664-53799686 GAAGGGTAGTGGGGGGCATATGG + Intergenic
1127599258 15:60518784-60518806 CAGGGTCAGTGAAGGGGAGAGGG - Intronic
1128589033 15:68878090-68878112 TAGGAGTATTGGAGGGGAGAAGG + Intronic
1128668531 15:69556859-69556881 CGGGGGCAGCGGAAGGCAGAAGG - Intergenic
1128744411 15:70103451-70103473 CAGAAGTTGTGGTGGGCAGAGGG + Intergenic
1128749682 15:70140106-70140128 CAGAGGTAGAGGAAGTCAGAAGG - Intergenic
1129258071 15:74345475-74345497 CAGAGGGAGTGGAGGGGAGTTGG - Intronic
1129263545 15:74382157-74382179 CCAGGGAAGTGGAGGGCAGGTGG + Intergenic
1129511527 15:76126898-76126920 CAGGGGTTGCGGGGGGCAGGTGG + Intronic
1129846576 15:78770576-78770598 CGGGGGTACTGGAGGGCTGGAGG + Intronic
1130099142 15:80878892-80878914 CTGGGGCAGTGGAGGGAAGAGGG - Intronic
1130255340 15:82323378-82323400 CGGGGGTACTGGAGGGCCGGAGG - Intergenic
1130599625 15:85266608-85266630 CGGGGGTACTGGAGGGCCGGAGG + Intergenic
1130667442 15:85881568-85881590 AAGGAGTAGTGGAAGGAAGAGGG - Intergenic
1131090893 15:89624375-89624397 CAGGGGGAGTTGAGGGAACAGGG - Exonic
1131376333 15:91927153-91927175 TCGGGGGAGTGGAGGGCCGAGGG - Intronic
1131468147 15:92672412-92672434 GAGCGGGAGGGGAGGGCAGATGG - Intronic
1131861056 15:96653593-96653615 CAGGGTTGGTCGGGGGCAGAGGG + Intergenic
1132119740 15:99166604-99166626 CAGGCGTTGTGGTGGGCAGACGG + Intronic
1132391108 15:101438867-101438889 CAGGGATATTGGAGCCCAGAGGG + Intronic
1132804242 16:1768392-1768414 CAGGGGATGTGGATGGCAGGAGG - Intronic
1132995209 16:2819138-2819160 CAGGGGCTGTGGGGGCCAGAAGG + Intronic
1133449608 16:5892731-5892753 CAGGGGTAGTGGGGAGAAAATGG + Intergenic
1134006919 16:10824181-10824203 CAGGGCTAGTGGTGGGGAAATGG + Intergenic
1134225113 16:12383858-12383880 GAAGGGTAGTGGAGGGAGGAGGG - Intronic
1135025560 16:18996634-18996656 AAGGGGGAATGGAGGGCGGAAGG + Intronic
1135414237 16:22256919-22256941 CAAGGGCTGTGGTGGGCAGAGGG - Intronic
1135552451 16:23408416-23408438 CAGGGGGTGAGCAGGGCAGAAGG + Intronic
1135603225 16:23801121-23801143 CAGGCGTCGTGGAGGGCACCTGG - Intergenic
1136033318 16:27519235-27519257 CTGGGGAAGGGGAGGGGAGAGGG + Intronic
1136120301 16:28128668-28128690 CAGGGGAAGTGCTGGGCAGAGGG - Intronic
1137055532 16:35744765-35744787 AAGGAGGAATGGAGGGCAGAAGG + Intergenic
1137547680 16:49415719-49415741 CAGAGGGAGGGGAGGCCAGAGGG + Intergenic
1137581181 16:49634522-49634544 GAGGGGGTGAGGAGGGCAGAGGG - Intronic
1137609810 16:49810767-49810789 CATGGGTATTTGAGGGCAGTCGG + Intronic
1137924460 16:52526687-52526709 CAGGCGTAGTAGAGAGAAGAGGG + Intronic
1138169139 16:54832420-54832442 CAGGGGTAAGGGTGGGAAGAAGG - Intergenic
1138667747 16:58586357-58586379 GAGGGGGAGGGGAGGGCAGGGGG + Intronic
1139068447 16:63349129-63349151 CAGGGGTAGGGTAGAGAAGAAGG - Intergenic
1140981208 16:80111571-80111593 ATGGGGTAGAAGAGGGCAGAGGG - Intergenic
1141662014 16:85446570-85446592 CAGCAGGAGTGGAGAGCAGAGGG + Intergenic
1141672380 16:85499047-85499069 CAGGAGGAGTTGAGGCCAGATGG + Intergenic
1141692478 16:85604172-85604194 TAGGGCTAGGGGAGGGGAGAGGG - Intergenic
1141814954 16:86403561-86403583 CAGTGGTGGTGGAAGGCAAAAGG + Intergenic
1141956594 16:87376079-87376101 CTGTGGCAGTGGAGGGCAGGGGG - Intronic
1142119113 16:88377223-88377245 CCGGGGTGGTGCAGGGCAGGGGG + Intergenic
1142765846 17:2063806-2063828 AAGGGGCTGTGGTGGGCAGAGGG + Intronic
1143052577 17:4138147-4138169 CTTGGGTAGTGGAGAGCTGAGGG + Intronic
1143114790 17:4576385-4576407 CAGGGTTAGTGGAGGTAAGGAGG + Intergenic
1143141599 17:4744534-4744556 GATGGGGAGTGGGGGGCAGAAGG - Intronic
1143272110 17:5683474-5683496 CTGGGGCCGTGGAGGGCAGGGGG + Intergenic
1143627836 17:8121461-8121483 CAGGTGTTGGGGAGGGCAGTGGG - Exonic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1145065651 17:19759740-19759762 CAGGGGGCAGGGAGGGCAGAGGG - Intergenic
1145735989 17:27232021-27232043 CTGGGATACTGTAGGGCAGAAGG + Intergenic
1147793817 17:43028810-43028832 CAGGGGAGCTGGAGGGCAGAAGG + Exonic
1147881392 17:43656387-43656409 CAGGGGTAGTGGAGGGGACCTGG + Intronic
1147947319 17:44087352-44087374 CAGGGGTGGAGAAGGACAGAGGG + Intronic
1148031783 17:44627122-44627144 CAGGTGTGGTTGACGGCAGAGGG + Intergenic
1148083005 17:44977773-44977795 CAGGGGTAGGAGTGAGCAGAGGG - Intergenic
1148721561 17:49757181-49757203 CTGGGGGGGTGGAGGACAGATGG - Intronic
1148767827 17:50049519-50049541 GAGGGGCAGCGGAGGGCGGAGGG + Intergenic
1148868904 17:50643977-50643999 CAGGGGCACTGGAGGGCAGAGGG + Intronic
1149950986 17:60985659-60985681 AAAGGGTAGTGGAGGGAGGAGGG - Intronic
1150357567 17:64500297-64500319 CAGGGGTAGAGGAGGCATGAAGG - Exonic
1150864590 17:68836297-68836319 CAGAGGTATGGGAGGGTAGAGGG + Intergenic
1150984847 17:70184530-70184552 GAGGGGGAGGGGAGGGGAGAGGG - Intergenic
1151296502 17:73190322-73190344 CAGGGATAGTGGGGGGCCCAGGG - Intergenic
1151827084 17:76529664-76529686 CAGGGGAAGAGGAGGGGAGGGGG - Intronic
1152323149 17:79619794-79619816 CAGGGCTGGAGGAGGGGAGATGG - Intergenic
1152467863 17:80475935-80475957 ACGGGGTGGGGGAGGGCAGAGGG + Intronic
1152608551 17:81304811-81304833 CAGGAAAAGGGGAGGGCAGAGGG - Intergenic
1152627010 17:81392530-81392552 CAGGGACATGGGAGGGCAGAGGG - Intergenic
1154079152 18:11237171-11237193 CAGGGGCAGAGGAAGCCAGAGGG - Intergenic
1155957038 18:31962931-31962953 CAGGGACAGTGCAGGGCAGAAGG + Intergenic
1155963631 18:32016650-32016672 CATGGGTGGTGGGGGGCAGGCGG - Intergenic
1156377630 18:36529039-36529061 GAGGGTTTCTGGAGGGCAGATGG + Intronic
1157481844 18:48060227-48060249 CAGGGGAAGCAGAGGGGAGAAGG + Intronic
1157550991 18:48581900-48581922 CAGGGGAAGGGGAGGTCATATGG + Intronic
1157622791 18:49025902-49025924 CAGAGGCCGTGGAGGCCAGAGGG - Intergenic
1157965734 18:52206182-52206204 CAAGGGCAGTGGAGGTCACAGGG + Intergenic
1158580910 18:58681958-58681980 CAGCAGTGGTGGAGGGCAGGAGG + Intronic
1159355927 18:67337417-67337439 CAGAAGTGGTGGAGGGTAGAAGG + Intergenic
1159913379 18:74167061-74167083 CAGGGGTTTTGGAGGCCAGAGGG - Intergenic
1160329953 18:77982236-77982258 CACGGGTACTGGAGGGTGGAGGG + Intergenic
1160663774 19:313393-313415 CAGGGGCCAGGGAGGGCAGAGGG - Intronic
1161550149 19:4908449-4908471 GAGGGGGAGTTGAGGTCAGAGGG - Intronic
1161711828 19:5853036-5853058 AAGGGGGAATGGAGGGCGGAAGG - Intergenic
1162094806 19:8304028-8304050 CAGGGGCAGGGGAGGCCAGGGGG + Exonic
1162311976 19:9913375-9913397 CAGGGGTAGAGGGGGACAGGTGG + Intronic
1162340932 19:10091378-10091400 CTGGGGTAGGGCAGGGCTGAGGG - Intronic
1162778918 19:12996511-12996533 GAGGGGCAGGGGAGGGGAGAGGG + Intronic
1162830011 19:13278544-13278566 CCGGGGGTGTGGTGGGCAGAGGG - Intronic
1162926357 19:13932223-13932245 CATGGGGGGTGGGGGGCAGAAGG - Intronic
1163790419 19:19302943-19302965 CAAGTGTAGTGTAGGGCCGAGGG - Intronic
1164004230 19:21134243-21134265 AAGGAGGAATGGAGGGCAGAAGG + Intergenic
1164648640 19:29876310-29876332 AAGGGGGTGTGCAGGGCAGAGGG + Intergenic
1164686216 19:30168392-30168414 CAGGGGGCGTGTAGGGAAGAGGG - Intergenic
1165282615 19:34810038-34810060 CGGGGGTGGTGGAGGGGAGAAGG - Intergenic
1165697789 19:37914097-37914119 CAGGGTAAGTGGAGAGCAAATGG + Intronic
1165950659 19:39472512-39472534 CAGGGGATGTGGTGGGTAGAAGG + Intronic
1166017384 19:39992934-39992956 CAGTCATAGTGGAAGGCAGAGGG - Intronic
1166072434 19:40395011-40395033 CAGGAGGAAGGGAGGGCAGAGGG - Exonic
1166154386 19:40899948-40899970 CAGGCACAGGGGAGGGCAGAAGG - Intergenic
1166321609 19:42022375-42022397 CAGGGGTGGAGGGGGACAGAGGG + Intronic
1166734233 19:45075303-45075325 GAGGGGGAGTGGAGGCCAGCTGG - Intronic
1167105776 19:47429346-47429368 CAGAGGTAGTGGAGGGCGAGTGG + Exonic
1167264061 19:48474705-48474727 GAGGGGTAGTGGGGAGGAGAGGG - Intronic
1167293272 19:48635875-48635897 CTGGGGCAGTGGTGGGCGGAGGG - Exonic
1167765341 19:51478816-51478838 CAGGGGTCGGGGAGAGGAGAAGG + Intronic
1168322296 19:55517720-55517742 CAGGGGTAGTAGTGGGGTGAGGG - Exonic
925423067 2:3727179-3727201 CAGGGGGAGGGGAGGGGAGGAGG - Intronic
925689373 2:6505618-6505640 GTGGGGTAGAGGAGGGAAGAGGG - Intergenic
926166162 2:10523082-10523104 CAGGGGCAGCAGAGGGCAGTGGG + Intergenic
926193074 2:10742692-10742714 CTGGGGTAGAGGATGGCTGAAGG - Intronic
927356279 2:22177385-22177407 CAGGGGTGTTGAAGGGCAGTAGG + Intergenic
927928152 2:27027110-27027132 CAGGGGGTGGGGAGGGCAGGTGG - Exonic
927930102 2:27038409-27038431 CAGGGCTAATGGAGGACAGGAGG + Intronic
928001912 2:27530770-27530792 GAGGGGTAGTGGTGGGGAGGTGG + Intergenic
929437534 2:41939903-41939925 CAGGGCTGTTGGAGGGCAAAAGG - Intronic
929814961 2:45223317-45223339 CATGGGTAGTGAGCGGCAGAGGG + Intergenic
930087305 2:47506851-47506873 TAGGGGTGGTGCAGGGGAGAGGG + Intronic
930771455 2:55134320-55134342 CAGGAGGAGTGGGGGGAAGAGGG - Intergenic
930873633 2:56190825-56190847 CTGGGGTAGGGGAGGAAAGAAGG - Intronic
931065618 2:58582968-58582990 AAAGGGGAGTGGAGAGCAGAGGG - Intergenic
931243038 2:60469343-60469365 CATGGGAAGAGGGGGGCAGAGGG - Intronic
932236558 2:70125234-70125256 CAGGGGTAGTGGAGGGCAGAGGG + Intergenic
933518406 2:83335946-83335968 TAGGGATGGTGGAGGGGAGAAGG - Intergenic
933816684 2:86074258-86074280 CATGGGTATGGGTGGGCAGAGGG + Intronic
934984327 2:98873417-98873439 TAGAGGTAGTGGAGCCCAGAAGG - Intronic
934997205 2:98975179-98975201 CAGAAGTAATGGAGGCCAGAAGG + Intergenic
935543746 2:104378822-104378844 GAGGGGTACTTGAGGGCAAATGG - Intergenic
935691983 2:105740397-105740419 CAGGGGAACTGGAGAGCAGAAGG + Intergenic
935718196 2:105957408-105957430 CAGATGTAGTGCAGGGCAGCTGG - Intergenic
935830689 2:106998104-106998126 CTCGGGAGGTGGAGGGCAGAAGG + Intergenic
936069736 2:109358051-109358073 CAGGGGTGGTGGAGGAGGGAGGG - Intronic
937064513 2:119007044-119007066 CTGGAGTAGTGGAAGGAAGAAGG - Intergenic
937126313 2:119476983-119477005 CAGGGGTAGGGGAGGGAAGGTGG + Intronic
937259218 2:120574776-120574798 CAAGGGCAGTAGGGGGCAGATGG - Intergenic
937373595 2:121319850-121319872 CAGGGGTAGTGGTGTGCAAGAGG - Intergenic
937792348 2:125975531-125975553 CAAGGGTAGTTGGGGGGAGAAGG + Intergenic
938157595 2:128954949-128954971 CAGCGGGAGCGGAGGACAGAGGG - Intergenic
938264947 2:129921992-129922014 CAGGGGGGGTGGGGGGCAGCAGG + Intergenic
938671293 2:133588975-133588997 CAGTGGTTGTGGAGGTCACATGG + Intergenic
939925810 2:148172466-148172488 CTGGGGTTGGGGAAGGCAGAGGG + Intronic
939995061 2:148912193-148912215 CAGGGGCAGGGGCTGGCAGAAGG + Intronic
940962391 2:159799882-159799904 CAGGGGTTGGGGTGGGAAGAAGG + Intronic
941195373 2:162444184-162444206 GAGGGGTAGGGGATGGCAGAGGG - Intronic
942229591 2:173847691-173847713 GAGGGGCTCTGGAGGGCAGAAGG + Intergenic
943933634 2:193886322-193886344 TAGGGGTAGTGGTGGCCACAGGG + Intergenic
944145521 2:196503551-196503573 GAGGGGAACAGGAGGGCAGAAGG - Intronic
944621172 2:201517311-201517333 CAGGGGTTGGGGAGGGGAAATGG - Intronic
944707129 2:202301700-202301722 AAGGCGTTTTGGAGGGCAGATGG - Intronic
945098901 2:206245829-206245851 CAGGCGTGGTGGCGGGCAGTTGG + Intergenic
945124281 2:206491146-206491168 CAGGGGTAGGGGCAGGCAGAGGG - Intronic
946026187 2:216673255-216673277 CAGAGGTGGTGGTGGGGAGATGG + Exonic
946404596 2:219485513-219485535 TGGGGGTAGGGGAGGGCAGGAGG - Intronic
946543031 2:220706840-220706862 CAGGGCTGGTAGAGGACAGAGGG - Intergenic
946630050 2:221657169-221657191 TAGGAGAAGTGGAGGGCTGAGGG + Intergenic
946633413 2:221697174-221697196 AAGGTGTATGGGAGGGCAGAGGG + Intergenic
946999236 2:225434235-225434257 CTGCTGTACTGGAGGGCAGAGGG - Intronic
947511003 2:230754367-230754389 GAGGGGAAGAGGAAGGCAGAAGG - Intronic
947544841 2:231003318-231003340 CAGGGGTCTTGCAGGACAGATGG - Intronic
947811875 2:233009874-233009896 CAGGTGGAGTGGAGGGAAGGTGG - Intronic
947922666 2:233891692-233891714 CAGGGGAGGTAGAGGGCAGAAGG + Intergenic
948310477 2:236981968-236981990 CAGGGGAAGTGCAGGGCTGGAGG + Intergenic
949075760 2:242056763-242056785 CAGGGGGACTGGAGGGCCGTGGG + Intergenic
1169080671 20:2796273-2796295 CAGGGTTCATGGAGGGCAGCAGG + Exonic
1169287036 20:4318069-4318091 AATTGGAAGTGGAGGGCAGAGGG + Intergenic
1169355502 20:4901620-4901642 CAGTGGGAGGGGAGGGCAGCCGG - Intronic
1170247625 20:14240678-14240700 CAGGCCTACTTGAGGGCAGAAGG + Intronic
1170560187 20:17550612-17550634 CGGGTGTGGTGGTGGGCAGATGG - Intronic
1171233820 20:23508800-23508822 TAGGAGCAGAGGAGGGCAGAAGG - Intergenic
1171448853 20:25222506-25222528 GAGGGGGAATGTAGGGCAGATGG + Intronic
1172280437 20:33703983-33704005 TAGGGGTTGGGGAGGGCAGAGGG - Exonic
1172451808 20:35031119-35031141 CAGGAATAATGGAAGGCAGAAGG - Intronic
1173226272 20:41164019-41164041 CAGGGCTGGGGGAGGGAAGATGG + Intronic
1173298613 20:41781234-41781256 CAGGGCTAGAGTAGTGCAGATGG + Intergenic
1173531261 20:43771575-43771597 CAGGGGCAGTGGAGGAAAGGGGG - Intergenic
1173758301 20:45537894-45537916 CAGAGGTAGTGCAGTGCAGGTGG + Intronic
1174292495 20:49519129-49519151 GTGGGGTGGTGGGGGGCAGACGG - Intronic
1174449095 20:50608981-50609003 CAGGGAGAGTGGAAGGCGGAGGG - Intronic
1175110523 20:56644843-56644865 CAGGGGAAGTGGAGAGTAGGGGG + Intergenic
1175239112 20:57533636-57533658 CAGGGATGATGGGGGGCAGATGG - Intergenic
1175417923 20:58813711-58813733 CAGGGGAAGAGGAGAGCAGCAGG - Intergenic
1175442462 20:59001413-59001435 AAGAGGGAGTGGAGGGCAGGAGG + Intronic
1175444512 20:59010752-59010774 CAGTGGTGCTTGAGGGCAGAGGG + Intergenic
1175482394 20:59320822-59320844 TGGGGGTTGTGGAGGGCAGGGGG + Intronic
1175787293 20:61720056-61720078 AGGCGGTAGTGGAGGGCAGTCGG + Intronic
1175828828 20:61951115-61951137 CAGGGCTGGGGGAGGGGAGAGGG - Intergenic
1175828847 20:61951150-61951172 CAGGGCTGGGGGAGGGGAGAGGG - Intergenic
1175941187 20:62538175-62538197 GAGGAGTGGTGCAGGGCAGAGGG + Intergenic
1176073741 20:63239263-63239285 CTGGGGCAGGGGAGGGCTGAGGG + Intronic
1176099734 20:63359470-63359492 CAGGGGTCTGGGTGGGCAGAGGG - Intronic
1176125545 20:63473007-63473029 GAGGGGGAGGGGAGGGCAGGGGG + Intergenic
1176298735 21:5088511-5088533 CTGGGGTGGTGAAGGGGAGAGGG - Intergenic
1177773145 21:25539450-25539472 CACTGCTTGTGGAGGGCAGAGGG - Intergenic
1177801783 21:25835107-25835129 CAGGGGTAGAGGGGTGAAGAGGG - Intergenic
1178915874 21:36705400-36705422 CTGGGGTAGGGGAGGGGAGAGGG - Intronic
1179385457 21:40937668-40937690 CTGGGGCAGAGGAGGGTAGAGGG - Intergenic
1179457137 21:41507711-41507733 CGGGGGCCGTGGAGGGCAGGCGG + Intronic
1179572681 21:42287147-42287169 CAGAGGCAGGAGAGGGCAGAGGG + Intronic
1179724681 21:43335511-43335533 CTGGGGTAGGAGAGGGCAGGAGG + Intergenic
1179858291 21:44173438-44173460 CTGGGGTGGTGAAGGGGAGAGGG + Intergenic
1180156216 21:45978352-45978374 GAGGGGGAGAGGAGGGAAGAGGG + Intergenic
1180170313 21:46055016-46055038 GAGGGGCTGTGCAGGGCAGAGGG - Intergenic
1181031878 22:20152278-20152300 CAGGGGCAGTGAGGGGCAGCAGG - Intergenic
1181148958 22:20869283-20869305 GAGGGGTAGTGGTTGGAAGAAGG + Intronic
1181169107 22:20998343-20998365 CAGGGGCAAGGCAGGGCAGAAGG - Exonic
1181236639 22:21451062-21451084 CCGGGGTGGGAGAGGGCAGAGGG - Exonic
1181720536 22:24771033-24771055 CAGGGGTGGTGAAGGGTACAGGG - Intronic
1181803721 22:25362736-25362758 TAGGGGCTGTGGAGAGCAGAGGG - Intronic
1181958393 22:26604966-26604988 CAGAGGGAGTGGAGGAAAGAGGG - Intronic
1182166309 22:28177847-28177869 TTGGGGGAGTGGAGGACAGATGG + Intronic
1182254802 22:29030733-29030755 CAGGGCTGGTGGAGGGGAGGAGG + Intronic
1182735952 22:32532451-32532473 CAGGTGTGGTGGCGGCCAGAGGG + Intronic
1183477485 22:38043455-38043477 TAGGGGTAGTGGTGGAGAGATGG - Intergenic
1183492955 22:38126555-38126577 CAGGGGGAGTGGGGGGATGAGGG - Intronic
1183738806 22:39658854-39658876 CAGGGGGAGAGGAAGACAGAGGG - Intronic
1184128559 22:42503706-42503728 TATGGGTAGTGGTGGTCAGAGGG - Intergenic
1184137353 22:42557021-42557043 TATGGGTAGTGGTGGTCAGAGGG - Intronic
1184152250 22:42645979-42646001 CAGGAGCAGTGGAGGGGCGAAGG + Intronic
1184341158 22:43886633-43886655 CAGGGCCAGGGGAAGGCAGAAGG - Intronic
1184829809 22:46977456-46977478 CAGGGGGAGTGGACAGCTGATGG + Intronic
1185108780 22:48889340-48889362 CGGGGGCACTGGAGGGGAGAGGG - Intergenic
1185166137 22:49263469-49263491 CAGGGGTGGTGGAGGGGACGGGG - Intergenic
1185238107 22:49726298-49726320 TAGTGATAGTGGTGGGCAGAGGG - Intergenic
1185324351 22:50218398-50218420 CAGGGCTGGCGGAGGGCAGAAGG + Exonic
949328921 3:2899684-2899706 CGGGGGTAGTGGATAGCAGTGGG + Intronic
949776052 3:7633610-7633632 CAGGAGTAGTGGAGGATAGAAGG - Intronic
950122328 3:10489944-10489966 CACCAGTAGTGCAGGGCAGAAGG - Intronic
950213618 3:11142040-11142062 AAGGGGTCCTTGAGGGCAGAGGG - Intronic
950398164 3:12750003-12750025 CCGGGGTAGTGGAGGGAGGAGGG + Intronic
950424832 3:12919463-12919485 CAGGGGAAGGGGAGGGCACCTGG + Intronic
950687432 3:14628643-14628665 CAGGGGCAGTGGAGAGCGCACGG - Intergenic
950965674 3:17144138-17144160 CAGGGGCTGAGGAGGGAAGAAGG - Intergenic
951467463 3:23017707-23017729 TAGGGGTAGGGGAGGGGAGAGGG + Intergenic
952377697 3:32781067-32781089 CTGGGGTGGGGGAGGGCCGAGGG - Intergenic
952867077 3:37861682-37861704 CAGGGTGAGTGGAGGGCGGGAGG - Intergenic
953878035 3:46677377-46677399 CAGCTGTAAGGGAGGGCAGAGGG - Intronic
954287573 3:49629786-49629808 CAAGGGTGGTGGGAGGCAGATGG - Intronic
954414248 3:50385182-50385204 AAGGGGGAGGGGAGGGAAGATGG + Intronic
954529491 3:51306256-51306278 CAGATATAGTGGAGGCCAGAAGG - Intronic
954916147 3:54149973-54149995 GAGGGGGAGGGGAGGGAAGAAGG - Intronic
954948339 3:54446401-54446423 CACAGGTGGTGAAGGGCAGAGGG + Intronic
955712031 3:61790133-61790155 CATGGGCAGTGGAGTACAGAGGG + Intronic
955972117 3:64445795-64445817 CTGGGGTAGGGGAGTGGAGATGG + Intergenic
956391116 3:68773510-68773532 CATGGGTAGAGGAGGGGAGCTGG - Intronic
956644785 3:71444891-71444913 CATGGGGACTGGAGGGTAGAGGG + Intronic
958822589 3:98992665-98992687 CAGGGGTTCAGGAGGTCAGAAGG - Intergenic
959095540 3:101951401-101951423 CAGGGGTAGGGGAGTGGAGCAGG + Intergenic
960844562 3:121994141-121994163 TTGGGATAGGGGAGGGCAGAGGG - Intronic
960877438 3:122311216-122311238 CCAGGGTAGTGCAGGCCAGATGG + Intergenic
960977062 3:123185823-123185845 GAAGGGTAGTAGAGGGCTGAGGG - Intronic
960997458 3:123349485-123349507 CAGGCGTCAGGGAGGGCAGAGGG - Intronic
961391257 3:126553461-126553483 CAGGGGTGGTGGGGGGCAGAAGG + Intronic
961415846 3:126756168-126756190 CCGAGGTAGGGGTGGGCAGAGGG - Intronic
962203054 3:133415766-133415788 AAGGGTAAGTGGAGGGGAGATGG - Intronic
962203439 3:133417327-133417349 CGGGGTGAGTGGAGGGGAGATGG - Intronic
962311886 3:134332594-134332616 TAGGGGGAGAGCAGGGCAGAAGG - Intergenic
962311894 3:134332620-134332642 TAGGGGGAGAGCAGGGCAGAAGG - Intergenic
962311902 3:134332646-134332668 TAGGGGGAGAGCAGGGCAGAAGG - Intergenic
962389923 3:134962780-134962802 CAGGAGGAGGGGAGGGCAGAGGG - Intronic
962426254 3:135271559-135271581 CAGAGGGAGTTGGGGGCAGAAGG + Intergenic
963571912 3:147008573-147008595 CTGGGGTAGTGCAGGTCACAGGG - Intergenic
963762794 3:149301238-149301260 CAGGGGTAGTGGAGAGCAAGTGG - Intergenic
965106569 3:164363058-164363080 CGAGTGGAGTGGAGGGCAGACGG + Intergenic
965155033 3:165040284-165040306 AAGGGGTAGGGAAGGGAAGAAGG + Intronic
965318533 3:167222411-167222433 GAAGGGTAGTGGAGGGTAGGAGG + Intergenic
965528595 3:169747818-169747840 TAGGGGTGGTGGAGGGAAGGGGG - Intergenic
965634735 3:170769552-170769574 CAGGTCTAGGGGAGGGCAGGAGG + Intronic
965759469 3:172060339-172060361 TAGTGGTGGTGGTGGGCAGAGGG + Intronic
965908457 3:173740522-173740544 CAGGGGTATGGGAGGGCATGAGG - Intronic
967195538 3:187022366-187022388 GAGGGTTAGGGGAGGGCTGAGGG + Intronic
967459776 3:189732252-189732274 CAGGGGTGGTGGAGGGGAGTTGG - Intronic
967880207 3:194296616-194296638 CAGGGGGAGGGGAGAGTAGAAGG + Intergenic
967952917 3:194854596-194854618 CAGGGGTTGTTGGGGGTAGAGGG + Intergenic
967962822 3:194939406-194939428 CAGGGGAGGTAGAGGGGAGACGG + Intergenic
968278460 3:197458325-197458347 CAGGGTGAGTGGAGGGCATGTGG - Intergenic
968286897 3:197514097-197514119 CTGGGGTGATGGTGGGCAGAGGG - Intronic
968727034 4:2252552-2252574 CTGGGGTGGGGGAGGGCAGCAGG + Intronic
969674186 4:8606137-8606159 CAGGGTTCATGGAGGGCAGCAGG - Exonic
970637148 4:18021883-18021905 GAGGGGGAGGGCAGGGCAGAGGG - Intergenic
971492076 4:27223791-27223813 CAGGAGTGGTGTAGGCCAGAAGG - Intergenic
972337711 4:38122396-38122418 CACTGGTTGTGCAGGGCAGAAGG - Intronic
972953876 4:44365159-44365181 CAGGGAGAGTGGTGGGCATATGG + Intronic
973566048 4:52188657-52188679 CAGGGCTACCTGAGGGCAGAGGG - Intergenic
973758304 4:54095809-54095831 GAGGGGTAGTTGTGAGCAGAGGG + Intronic
975151923 4:71032458-71032480 AAGGGGGAATGGAGGGCGGAAGG - Intergenic
976201569 4:82584763-82584785 CAGAGGTGGTGGAGGGGAGGGGG - Intergenic
976744803 4:88392068-88392090 AGGGGGGAGTGGAGGGGAGAAGG - Intronic
978303379 4:107294905-107294927 AAGGGGTAATGGAGGGTGGAAGG + Intergenic
979132891 4:117070627-117070649 CAGGGATAATGGAGGCAAGAAGG - Intergenic
979382986 4:120030490-120030512 CAGGGGTTGTGGAGAGTTGAGGG - Intergenic
979677845 4:123429196-123429218 TAGGGTAAGTGGAGGGAAGATGG + Intergenic
981032941 4:140144127-140144149 CAGGGGTAGAAGTGGGTAGAAGG - Intronic
981532214 4:145763843-145763865 GAGGGGGAGGGGAGGGCAGAAGG - Intronic
981841287 4:149115526-149115548 AAGGGGAAGAGGAGAGCAGATGG + Intergenic
982129247 4:152212499-152212521 CAGGGGTAGTCAAGGCCAGGAGG + Intergenic
983017285 4:162628729-162628751 CTGGGGTGGTGGTGGTCAGAGGG + Intergenic
983562549 4:169115688-169115710 CAGGGGTGGTGGCGGGGAAATGG - Intronic
984824278 4:183910499-183910521 CAGGGCTGGGGGAGGGGAGAGGG - Intronic
984911483 4:184677040-184677062 AAGGGGAAGGGGAGGGGAGAAGG - Intronic
985025702 4:185737318-185737340 CAGGGGGTGTGGAGAGCAGGTGG + Intronic
985427369 4:189843902-189843924 CAGATGCAGTGGAGGGAAGAAGG - Intergenic
985586452 5:740122-740144 CAGGGGGAGTGGTGGGAGGAGGG + Intronic
985601040 5:832299-832321 CAGGGGGAGTGGTGGGAGGAGGG + Intronic
985615379 5:916934-916956 CAGGGGCTGTGGATGCCAGATGG + Intronic
985784831 5:1887996-1888018 CAGGGTTAGGGGAGGGCATGGGG + Intergenic
985872606 5:2569349-2569371 CAGGGGCCGTGGCGGGCAGCCGG + Intergenic
986081102 5:4394991-4395013 CTAGGGGAGTGGAGTGCAGAAGG - Intergenic
987232937 5:15913930-15913952 CGGGGGTTGGGGAGGGCAGGGGG + Intronic
987278025 5:16382922-16382944 CCGGGGTGATGGAAGGCAGAGGG - Intergenic
987865419 5:23529459-23529481 CAGGGGTGGTGCAGAGAAGAAGG + Intergenic
988965577 5:36414169-36414191 CAGGGGTTAGGGAGGACAGAGGG + Intergenic
989615304 5:43332426-43332448 AAGGAGGAATGGAGGGCAGAAGG + Intergenic
991541478 5:67734265-67734287 AACGAGTAGTGGAGGTCAGAGGG + Intergenic
991663681 5:68974811-68974833 CAGGGGTAGTGGTGGCTACAGGG + Intergenic
993503068 5:88683626-88683648 CAGGTGTAATGGATGGCAGGGGG + Intergenic
994109138 5:95980898-95980920 CATGGGTATTGGTGGGCAGGAGG - Intergenic
995034557 5:107518490-107518512 CTGGGGGACTGGTGGGCAGAAGG + Intronic
995250178 5:109984202-109984224 CAGGGGTAGTGGTGGGAAATGGG + Intergenic
995289560 5:110435605-110435627 CAGAGGTAGTGAAGGGTAGAGGG - Intronic
996346416 5:122493145-122493167 CAGGGGTAAAGGAGGACTGAAGG + Intergenic
996682505 5:126243114-126243136 CAGAGATAGTGGAGGCCAGAAGG - Intergenic
997240514 5:132303416-132303438 AAGGGGAAGGGGAGGGCTGAAGG - Intronic
997472179 5:134123240-134123262 CAAGGGTAGGGTAGGCCAGAGGG - Intronic
997476354 5:134144756-134144778 GAGGGGTAGAGCAGGGCAGAGGG - Intronic
997596955 5:135113474-135113496 CAGGGGCAGAGGCGGGCAGGGGG - Intronic
997709394 5:135990952-135990974 CAGCGGAAGTGGAGAGCAGTGGG + Intergenic
999365914 5:151023292-151023314 AAGGGATAGTGGGGGTCAGAAGG - Intronic
999607606 5:153333259-153333281 CAGGGGTGGTGGGGGGCAAGGGG - Intergenic
999682149 5:154070374-154070396 GAAGGGTAGTGGGGGACAGAGGG + Intronic
1000790907 5:165605987-165606009 CAGTGGTAATGGTGAGCAGAAGG - Intergenic
1000908493 5:166993021-166993043 CAGGAGTGGGGGAGGGGAGAGGG - Intergenic
1001141341 5:169146536-169146558 AAGGGGGTGTGGAGGTCAGAAGG - Intronic
1001335774 5:170795447-170795469 CAGGGGTGGAGGACGGCAGCTGG + Intronic
1001531966 5:172469691-172469713 CAGTGGCAGTGGAGGCCACATGG - Intergenic
1002374082 5:178775707-178775729 CAGGGGCAGCTGAGGGCACAAGG + Intergenic
1002392648 5:178927943-178927965 CAGTCATAGTGGAGGGCAAAAGG + Intronic
1003052828 6:2795671-2795693 CAGGGGGAGAGGAAGGCACAGGG - Intergenic
1003516171 6:6820892-6820914 CAGGGGCAATGCAGGGGAGAGGG + Intergenic
1003516531 6:6823230-6823252 CAGGGGTGGTGGCTGGCAGGTGG - Intergenic
1004009130 6:11664739-11664761 TAGAGGTGGTGGAGGACAGAAGG + Intergenic
1004250784 6:14021726-14021748 GAGGGGGAGGGGAGGGAAGAAGG - Intergenic
1005436964 6:25822961-25822983 CAGTGGTGGGGGAGGGCAGGAGG - Intronic
1005786728 6:29251690-29251712 AAAGGGGAATGGAGGGCAGAAGG + Intergenic
1005827327 6:29641882-29641904 CACTGTTAGTGAAGGGCAGAAGG - Intergenic
1005971247 6:30763651-30763673 CAGAGGCAGTGGAGGGCTGGGGG - Intergenic
1005997557 6:30940683-30940705 CTGGGGAAGTGGGGAGCAGATGG - Intergenic
1006051452 6:31348058-31348080 TGGAGGTGGTGGAGGGCAGAGGG - Intronic
1006153872 6:32003707-32003729 CAGGGGTAGATGAGGGCATCTGG + Intergenic
1006160180 6:32036444-32036466 CAGGGGTAGATGAGGGCATCTGG + Intergenic
1006449783 6:34099276-34099298 CAGGGGTACAGGTGGTCAGATGG + Intronic
1006699754 6:35962484-35962506 CTGAGGAAGGGGAGGGCAGAGGG - Intronic
1007177923 6:39909219-39909241 CAGGGGAGGGGGAGGGGAGAGGG + Intronic
1007228876 6:40334426-40334448 CAGGGGTAGAGCAGGTCAAAAGG - Intergenic
1007229358 6:40337749-40337771 CAGGGGTTGTGGTGGGGGGATGG - Intergenic
1007254624 6:40520265-40520287 AAGGGGTGGAGGAGTGCAGAGGG + Intronic
1007345175 6:41223690-41223712 CAGGGGATTTGGAGGGCAGTGGG - Intergenic
1007384698 6:41512789-41512811 CAGGGCTGGGGGAGAGCAGAGGG - Intergenic
1008548562 6:52605280-52605302 CAGGGGCAGGGGAGGGTAGGAGG + Intergenic
1008624074 6:53300721-53300743 CAGACGGAGTGGAGGACAGAAGG - Intronic
1010488530 6:76446580-76446602 CAGGGGTAGGGAATGGAAGAGGG + Intergenic
1012148318 6:95714253-95714275 AAGGGGTAATGCATGGCAGATGG + Intergenic
1012365777 6:98437776-98437798 TAGGGAGAGTGGAGGGGAGATGG + Intergenic
1012968138 6:105697592-105697614 TAGGGGGAGGGGTGGGCAGAGGG + Intergenic
1013623074 6:111909222-111909244 CAGAGGTGCAGGAGGGCAGAAGG - Intergenic
1014639996 6:123897801-123897823 CAGAGGCAGTGAAGGGAAGAGGG - Intronic
1014769458 6:125444787-125444809 CAGGGGTGGGGGTGGGGAGACGG - Intergenic
1014963887 6:127722423-127722445 GAGGGTTAGTGGAGGGCAGTTGG - Intronic
1017196705 6:151709130-151709152 CTGGGGCAGTGTCGGGCAGAGGG - Intronic
1019142899 6:169959503-169959525 CAGGGGGAGAGGAGGGAGGAGGG - Intergenic
1019563058 7:1667391-1667413 CGGGGGTTGTGGAGGGCAGGGGG + Intergenic
1019575765 7:1736989-1737011 CAGGGGTAGCTGGGGGCAGGTGG - Intronic
1019686737 7:2386046-2386068 CAGGGGGAGTGGACTGCAGAGGG + Intergenic
1019932105 7:4230453-4230475 GAAGGGGAGTGGAGGGCAGGGGG + Intronic
1021174667 7:17437428-17437450 GTGGGGAATTGGAGGGCAGAAGG + Intergenic
1021866375 7:24962388-24962410 AGGGGGGAGGGGAGGGCAGAAGG + Intronic
1022509072 7:30923662-30923684 CAGGGGCAGGGGCGGGCGGAGGG + Exonic
1023125546 7:36950983-36951005 CAGGGGTAGTGGTGGAGAGGGGG - Intronic
1023156405 7:37256606-37256628 AAAGGGGAGGGGAGGGCAGAGGG + Intronic
1023256827 7:38320653-38320675 TAAGGGTGGTGGGGGGCAGAAGG - Intergenic
1023699373 7:42877616-42877638 GAGGGGGACTGGTGGGCAGAGGG - Intergenic
1023796026 7:43792963-43792985 CACAGATAGTGGAGGGCAGAAGG + Intronic
1023863146 7:44227230-44227252 GAGGGGAAGTGGAAGACAGAGGG + Intronic
1023863279 7:44227595-44227617 CAGGGGGTGTGGGGGACAGAGGG + Intronic
1023978382 7:45050905-45050927 AGGGGGTAGGGTAGGGCAGAGGG + Intronic
1024050841 7:45622322-45622344 CAGGTCTAGTGGAGGGCAGATGG + Intronic
1024804147 7:53116775-53116797 CTGGGGGAGAGGAGGGCATATGG + Intergenic
1025140484 7:56459430-56459452 CATGGGCAGTGGGGGGCAGTTGG + Intergenic
1025907651 7:65800312-65800334 CAGGGAAAGTGGAGAGCAAAGGG - Intergenic
1025981436 7:66410472-66410494 CAGGGAAAGTGGAGAGCAAAGGG + Intronic
1026287692 7:68977665-68977687 CTGGGGGAGAAGAGGGCAGAAGG + Intergenic
1026828862 7:73599797-73599819 CATGGGGACTGGCGGGCAGAGGG + Intronic
1026861584 7:73793507-73793529 CAGGGGTACTGCAGGTGAGAGGG + Intergenic
1026906480 7:74065819-74065841 CAGGGGTAGGGGGAGCCAGAGGG - Intronic
1027297546 7:76793249-76793271 GAGGGGTGGAGGAGGGCTGAAGG - Intergenic
1027587967 7:80081593-80081615 CAGGGGTAGCGGATGGAAGCTGG + Intergenic
1028267267 7:88741734-88741756 AAAGGGTAGTGGAGAGCTGAGGG - Intergenic
1028722448 7:94049043-94049065 GAAGGGTAGTGGAGGGCTGAGGG + Intergenic
1029055132 7:97733149-97733171 CAGGGGGATTGGAGGGCCGGAGG + Intronic
1029438578 7:100575432-100575454 CAGGGGGAGTGCAGTGCAGGAGG + Intronic
1029488462 7:100857269-100857291 CAGAGGGAATGGAGGGCAGGAGG + Intronic
1032417481 7:131747594-131747616 CAGAGGTATTGGAGAGGAGATGG + Intergenic
1032490107 7:132318141-132318163 CAGGGGGACTGGAGCGGAGAGGG + Intronic
1032540489 7:132699116-132699138 CAGGGGTGGTGGGAGGGAGAAGG - Intronic
1032878065 7:136059063-136059085 CAGGAGTAGTGAAGGGTAGTAGG + Intergenic
1033242308 7:139690282-139690304 CAGAGTCAGGGGAGGGCAGAGGG + Intronic
1033638550 7:143237699-143237721 CAGTGGTAGTGGTGGGCACTGGG + Intergenic
1034269114 7:149795164-149795186 CTGGAGTAGGGGAGGACAGAGGG - Intergenic
1034422069 7:150995646-150995668 CAGGGGTGGGAGAGGGAAGAGGG - Intronic
1034422278 7:150996170-150996192 CAGGGGTGGGAGAGGGGAGAGGG - Intronic
1034944174 7:155251208-155251230 CTGGGGCACTGGAAGGCAGATGG + Intergenic
1034988152 7:155530420-155530442 CAGGGGTCATGGAGGGGAGAGGG - Intronic
1035121628 7:156573163-156573185 CTGCGGCAATGGAGGGCAGAGGG + Intergenic
1035206925 7:157299964-157299986 CAGGGTTAGAGCAGGGCGGAGGG - Intergenic
1035412746 7:158658197-158658219 CAGGGAGAGGGAAGGGCAGAAGG + Intronic
1035945309 8:3955164-3955186 CACGGGTGGTGGAGGACAGGAGG - Intronic
1036793143 8:11736615-11736637 CTGGAGGAGTGGTGGGCAGAAGG + Intronic
1037822417 8:22141415-22141437 CCGGGGTAGAGGAGGTCTGAGGG + Intronic
1037826350 8:22162815-22162837 CAAGGGGAGTGGAGGGGAGGAGG + Intronic
1038424879 8:27458644-27458666 CAGGGGTAGGGGTGGGGAGAGGG - Exonic
1038598384 8:28911801-28911823 CAGGGTTGGGGGAGGGCAGAGGG + Intronic
1038665201 8:29531714-29531736 CAGAGATAGGGGATGGCAGAAGG - Intergenic
1039202916 8:35116594-35116616 GAGGGCTACTAGAGGGCAGAGGG - Intergenic
1039499149 8:38003160-38003182 AAGGAGGAATGGAGGGCAGAAGG + Intergenic
1039983675 8:42429804-42429826 CAGGGGTAGTGGAGCAGAGCAGG - Intronic
1040479311 8:47809139-47809161 GAGGGGGAGGGGAGGGGAGAAGG + Intronic
1041423242 8:57692819-57692841 CAGAGGTCATGGAGGGGAGAGGG + Intergenic
1041714320 8:60920480-60920502 TTGGGGTAGTGGAGGGGAGGGGG - Intergenic
1042130498 8:65582779-65582801 GAGGGGGAGGGGAGGGGAGAGGG + Intergenic
1042212505 8:66394887-66394909 CTGGTGTGATGGAGGGCAGAAGG + Intergenic
1043597605 8:81902998-81903020 AAGGGGGAATGGAGGGTAGAAGG + Intergenic
1043961799 8:86424856-86424878 GAGGGGGAGGGGAGGGGAGAGGG + Intronic
1044146810 8:88725890-88725912 AAGGGGTTGTTGAGGGGAGAAGG + Intergenic
1044940771 8:97340900-97340922 CGGGGGTGGTGGTGGGGAGAGGG + Intergenic
1045480832 8:102590866-102590888 CAGTAGTAGTGAGGGGCAGAGGG + Intergenic
1046547501 8:115669346-115669368 TTGGGGTAGTGGGGGGCAGGTGG + Intronic
1047731934 8:127735586-127735608 CAGGGAGAGTGGAGGAAAGAAGG - Intronic
1048286397 8:133145173-133145195 CAGAGGAAGAGGAAGGCAGAAGG + Intergenic
1048402042 8:134081293-134081315 CAGGAGCAGTGGGAGGCAGATGG - Intergenic
1048444357 8:134482113-134482135 CAGGCTTAGTGATGGGCAGAAGG - Intronic
1049095207 8:140544601-140544623 CAGAGGGAGTAGAGGGTAGAAGG - Intronic
1049217759 8:141415658-141415680 CAGGGGTGGTGAAGGGTAGGGGG + Intronic
1049241082 8:141537683-141537705 CAGGGGGAGGGCAGGGCTGATGG - Intergenic
1049414056 8:142487424-142487446 CAGCCCCAGTGGAGGGCAGAGGG - Intronic
1049471318 8:142776186-142776208 CAGGGATGATGGTGGGCAGAGGG + Intronic
1049621410 8:143599896-143599918 CAGGGGGAGGGGAGGAGAGATGG - Exonic
1049708534 8:144053607-144053629 CAGGGGTTGTGGACCACAGAGGG - Intronic
1049854897 8:144855255-144855277 CAGGGGGAGAGGAGGGCAGTAGG + Intergenic
1050230990 9:3525986-3526008 GAGGGGTGGGGGAGGGAAGAGGG + Intronic
1050245479 9:3685366-3685388 CAGGGGTTGGGGATGGCAGAGGG - Intergenic
1050513052 9:6413983-6414005 CAGAGGGCGGGGAGGGCAGAGGG + Intronic
1051123797 9:13780903-13780925 AAAGGGTAGTGGAGGGCATAGGG - Intergenic
1051432716 9:16996585-16996607 GAAGGGTAGTGGAGGGCTGGTGG + Intergenic
1051642686 9:19238466-19238488 AAGGGGGAGGGGAGGGGAGAGGG - Intronic
1051765962 9:20524024-20524046 CAGGGGAAGTGGCAGGGAGAAGG + Intronic
1052059089 9:23938838-23938860 CAGGGGTACTGGAGTCCTGAAGG - Intergenic
1052480981 9:29025801-29025823 CAGGGGTGGTTAAGGGTAGAGGG - Intergenic
1052673087 9:31583380-31583402 AAAGGGTAGTGGAGGGCTGGGGG - Intergenic
1052951916 9:34219948-34219970 AAGGGGGAGGGGAGGGGAGAGGG - Intronic
1053060119 9:35024099-35024121 AAGGGGGAATGGAGGGCGGAAGG + Intergenic
1056516806 9:87359809-87359831 CTGGGGTAGTGGTGGCCACAGGG + Intergenic
1056627897 9:88269199-88269221 CATGAGTAGTGCAGGGAAGAAGG - Intergenic
1056832738 9:89929860-89929882 CAGGGGCAGAGGAAGGGAGAAGG + Intergenic
1057825903 9:98371905-98371927 GAGGGGAAGTGAAGGCCAGAGGG - Intronic
1058382823 9:104396614-104396636 CAGGGGCAGCGAAGGGGAGATGG + Intergenic
1059177400 9:112179777-112179799 CATGGGTATGGGAAGGCAGAGGG + Intergenic
1059304978 9:113346945-113346967 AAGAGGTTGTGGAGGGCAGGGGG - Intergenic
1060185620 9:121562375-121562397 GAGGGGTAGGGCTGGGCAGAGGG - Intergenic
1060188572 9:121578358-121578380 TAGGGGGAGAGGAGGGAAGAGGG - Intronic
1060232703 9:121837613-121837635 CAGGGCTGGTTGATGGCAGATGG - Intronic
1060421639 9:123473319-123473341 GAGGGGCAGGGGAGGGCGGAGGG + Intronic
1060591113 9:124817511-124817533 ATGGGGTAGTGGGGAGCAGATGG - Intergenic
1060697085 9:125718565-125718587 CAGAGGTATTGGTGGGGAGAGGG + Intergenic
1060733184 9:126050609-126050631 GAGGGGTACGGGAGGGGAGAGGG - Intergenic
1060772447 9:126342365-126342387 CCTGGGTAGTGGGTGGCAGATGG + Intronic
1060859044 9:126938886-126938908 CAGGAGTAGAGGAGGGAGGAGGG + Intronic
1061369538 9:130190761-130190783 CAGGGGTGGAGGAGTGGAGATGG - Intronic
1061416640 9:130450813-130450835 CTGGGGAAGTGGAGCCCAGAAGG - Intronic
1061664885 9:132154828-132154850 CCGGGGCAGTGGGAGGCAGAGGG + Intergenic
1062118422 9:134821418-134821440 CGAGGGTAGCGGAGGGCTGATGG - Intronic
1062335116 9:136061517-136061539 CTGGGGTAGGGGAAGGCGGATGG + Intronic
1062362608 9:136194757-136194779 AAGGGGAAGGGGAGGGAAGAGGG - Intergenic
1062721123 9:138044696-138044718 CAGGTGGACGGGAGGGCAGAGGG + Intronic
1185537306 X:872790-872812 GAGGGGAAGGGGAGGGGAGAGGG - Intergenic
1185537315 X:872808-872830 GAGGGGAAGGGGAGGGGAGAGGG - Intergenic
1185859209 X:3562016-3562038 CAGGGGCTGGGGAGGGGAGAAGG - Intergenic
1186844049 X:13513399-13513421 GAAGGGTAGTTGGGGGCAGAGGG - Intergenic
1187412498 X:19063318-19063340 CAGGGCTAGGGGAGTGGAGAGGG - Intronic
1188463522 X:30453522-30453544 AAGGGGGAATGGAGGGTAGAAGG + Intergenic
1188474758 X:30579538-30579560 GAAGGGTAGTGGAGGGCTGGTGG - Intergenic
1189725436 X:43964070-43964092 CAGGGGTGGTGGGGGGGTGAGGG + Intronic
1190047342 X:47123272-47123294 CAGTGATTGTGGAGGGCAGGGGG + Intergenic
1190184810 X:48224283-48224305 CAGGGGGAGAGGAGAGGAGAGGG + Intronic
1190197382 X:48331144-48331166 CAGGGGGAGAGGAGAGGAGAGGG + Intergenic
1190321824 X:49184317-49184339 GAGGGGTGCTGGAGGCCAGAGGG + Intronic
1190595808 X:52052011-52052033 CATGGGAAATGGAGGGCAGCTGG + Exonic
1190613016 X:52202062-52202084 CATGGGAAATGGAGGGCAGCTGG - Exonic
1190664123 X:52681554-52681576 CAGGGGGAGAGGAGAGGAGAGGG + Intronic
1190675299 X:52776868-52776890 CAGGGGGAGAGGAGAGGAGAGGG - Intronic
1190983517 X:55479993-55480015 CACGGGTAAGGCAGGGCAGATGG + Intergenic
1190985182 X:55493190-55493212 CACGGGTAAGGCAGGGCAGATGG - Intergenic
1190990212 X:55540793-55540815 AAGCGGTAGTGGGGGGCAGGTGG + Intergenic
1192315803 X:70050374-70050396 CAATGGGATTGGAGGGCAGAGGG + Intergenic
1193403687 X:81076915-81076937 CATGGGGTGTGGAGGGCAGGGGG + Intergenic
1193670744 X:84382697-84382719 GAAGTGTAGTGGAGGGCATAAGG + Intronic
1194216855 X:91140866-91140888 AAGGGATAGTGGAGGGTACAGGG - Intergenic
1195274071 X:103262227-103262249 CAGGGGTAGAGATGGGAAGATGG - Intergenic
1196237448 X:113299785-113299807 CAGGGGATGGGGAGGGGAGAGGG - Intergenic
1196469703 X:116011566-116011588 AAGGAGGAATGGAGGGCAGAAGG - Intergenic
1196586578 X:117436109-117436131 CAGGGGTAGAGGAGAGAAGGGGG - Intergenic
1197376043 X:125682777-125682799 CAGTGGTGGTGGTGGGCACAGGG + Intergenic
1200091672 X:153638897-153638919 CAGGGGAAGAGGAGGAGAGAGGG - Intergenic
1200397452 X:155999509-155999531 CAGGGGTAGGGATGGGCAGGAGG - Intronic
1200684683 Y:6247692-6247714 GATGGGTAGTGGAAGGAAGATGG + Intronic
1200990213 Y:9338957-9338979 GATGGGTAGTGGAAGGAAGATGG + Intronic
1200992875 Y:9359272-9359294 GATGGGTAGTGGAAGGAAGATGG + Intronic
1200995528 Y:9379550-9379572 GATGGGTAGTGGAAGGAAGATGG + Intronic
1200998194 Y:9399896-9399918 GATGGGTAGTGGAAGGAAGATGG + Intronic
1201000703 Y:9468430-9468452 GATGGGTAGTGGAAGGAAGATGG + Intronic
1201003369 Y:9488760-9488782 GATGGGTAGTGGAAGGAAGATGG + Intronic
1201006025 Y:9509042-9509064 GATGGGTAGTGGAAGGAAGATGG + Intergenic
1201008683 Y:9529355-9529377 GATGGGTAGTGGAAGGAAGATGG + Intronic