ID: 932238924

View in Genome Browser
Species Human (GRCh38)
Location 2:70142326-70142348
Sequence CCGCTGCCCTGTAAAACCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932238909_932238924 26 Left 932238909 2:70142277-70142299 CCGTCTCGAGGTCGGGGTGCGGC No data
Right 932238924 2:70142326-70142348 CCGCTGCCCTGTAAAACCTGCGG No data
932238914_932238924 -3 Left 932238914 2:70142306-70142328 CCACGTGCCCCAAATCCCCCCCG No data
Right 932238924 2:70142326-70142348 CCGCTGCCCTGTAAAACCTGCGG No data
932238915_932238924 -10 Left 932238915 2:70142313-70142335 CCCCAAATCCCCCCCGCTGCCCT No data
Right 932238924 2:70142326-70142348 CCGCTGCCCTGTAAAACCTGCGG No data
932238913_932238924 -2 Left 932238913 2:70142305-70142327 CCCACGTGCCCCAAATCCCCCCC No data
Right 932238924 2:70142326-70142348 CCGCTGCCCTGTAAAACCTGCGG No data
932238911_932238924 3 Left 932238911 2:70142300-70142322 CCGACCCCACGTGCCCCAAATCC No data
Right 932238924 2:70142326-70142348 CCGCTGCCCTGTAAAACCTGCGG No data
932238912_932238924 -1 Left 932238912 2:70142304-70142326 CCCCACGTGCCCCAAATCCCCCC No data
Right 932238924 2:70142326-70142348 CCGCTGCCCTGTAAAACCTGCGG No data
932238910_932238924 4 Left 932238910 2:70142299-70142321 CCCGACCCCACGTGCCCCAAATC No data
Right 932238924 2:70142326-70142348 CCGCTGCCCTGTAAAACCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932238924 Original CRISPR CCGCTGCCCTGTAAAACCTG CGG Intergenic
No off target data available for this crispr