ID: 932239056

View in Genome Browser
Species Human (GRCh38)
Location 2:70142764-70142786
Sequence GGTGACGTGTCCCGTGCGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932239049_932239056 23 Left 932239049 2:70142718-70142740 CCTCCGGCGCTCTCATTCCCGCG No data
Right 932239056 2:70142764-70142786 GGTGACGTGTCCCGTGCGCCAGG No data
932239055_932239056 -4 Left 932239055 2:70142745-70142767 CCAGAAAAGACGCGAAGGTGGTG No data
Right 932239056 2:70142764-70142786 GGTGACGTGTCCCGTGCGCCAGG No data
932239050_932239056 20 Left 932239050 2:70142721-70142743 CCGGCGCTCTCATTCCCGCGCTC No data
Right 932239056 2:70142764-70142786 GGTGACGTGTCCCGTGCGCCAGG No data
932239051_932239056 6 Left 932239051 2:70142735-70142757 CCCGCGCTCTCCAGAAAAGACGC No data
Right 932239056 2:70142764-70142786 GGTGACGTGTCCCGTGCGCCAGG No data
932239047_932239056 27 Left 932239047 2:70142714-70142736 CCACCCTCCGGCGCTCTCATTCC No data
Right 932239056 2:70142764-70142786 GGTGACGTGTCCCGTGCGCCAGG No data
932239048_932239056 24 Left 932239048 2:70142717-70142739 CCCTCCGGCGCTCTCATTCCCGC No data
Right 932239056 2:70142764-70142786 GGTGACGTGTCCCGTGCGCCAGG No data
932239052_932239056 5 Left 932239052 2:70142736-70142758 CCGCGCTCTCCAGAAAAGACGCG No data
Right 932239056 2:70142764-70142786 GGTGACGTGTCCCGTGCGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932239056 Original CRISPR GGTGACGTGTCCCGTGCGCC AGG Intergenic