ID: 932240197

View in Genome Browser
Species Human (GRCh38)
Location 2:70150386-70150408
Sequence CAGTTCCAAGGGCTGGTCCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 5, 3: 44, 4: 234}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932240197 Original CRISPR CAGTTCCAAGGGCTGGTCCA AGG Exonic
900095305 1:937748-937770 CAGTCCCACGGTCTGGTCCAGGG - Intronic
901072418 1:6528224-6528246 CAGATCCAGGGTCTGGACCAGGG - Intronic
901425541 1:9180557-9180579 CAGTTACAAGGGCAGGTGTAGGG + Intergenic
902284138 1:15395488-15395510 CAGTTCAAAGGGCCAGCCCAGGG + Intronic
903169588 1:21543913-21543935 CAGCTCCCAGGCCTGCTCCAAGG - Intronic
903269271 1:22177582-22177604 CAGTTAAAAGGGCAGGGCCAGGG + Intergenic
904112059 1:28133798-28133820 GTGTTCCAAGGGATGGGCCAGGG + Intergenic
905013231 1:34760775-34760797 CAGCTGCCAGGGCTGGGCCAGGG - Intronic
907305455 1:53510473-53510495 GAGTGCCATGGGCTGCTCCAGGG - Intronic
909832386 1:80209029-80209051 CAGATCAAAGGGGAGGTCCAGGG + Intergenic
911497838 1:98651892-98651914 CAGTTCCAGGGGCTGGGACTGGG + Intergenic
912721611 1:112025060-112025082 CAGTTCCTAGAGCAGGTCCCAGG - Intergenic
914689548 1:150013247-150013269 CAATTCTAAGGGCTGCTTCAAGG + Intergenic
918082285 1:181217006-181217028 AAATTCCAGGGGCTGGCCCAAGG - Intergenic
919200375 1:194348733-194348755 CAGTTTCACGGGCTGGGCCCAGG + Intergenic
922865802 1:228860597-228860619 AGGGTCCAAGGGCTGCTCCATGG + Intergenic
924175991 1:241391489-241391511 CACATCCAATGTCTGGTCCATGG + Intergenic
1062839165 10:657215-657237 CAGGTCCAGGGGCAGGTCCAGGG - Intronic
1062839170 10:657227-657249 CAGGTCCAGCGGCAGGTCCAGGG - Intronic
1062839179 10:657263-657285 CAGGTCCAGGGGCAGGTCCAGGG - Intronic
1062839184 10:657275-657297 CAGGTCCAGTGGCAGGTCCAGGG - Intronic
1062839191 10:657299-657321 CAGGTCCAGGGGCAGGTCCAGGG - Intronic
1062839196 10:657311-657333 CAGGTCCAGGGGCAGGTCCAGGG - Intronic
1062839201 10:657323-657345 CAGGTCCAGGGACAGGTCCAGGG - Intronic
1062839205 10:657335-657357 CAGGTCCAGCGGCAGGTCCAGGG - Intronic
1062839218 10:657383-657405 CAGGTCCAGGGGCAGGTCCAGGG - Intronic
1062839223 10:657395-657417 CAGGTCCAAGGGCAGGTCCAGGG - Intronic
1062839228 10:657407-657429 CAGGTCCAGGGACAGGTCCAAGG - Intronic
1062839231 10:657419-657441 CAGGTCCAGGGACAGGTCCAGGG - Intronic
1062839243 10:657467-657489 CAGGTCCAGGGGCAGGTCCAGGG - Intronic
1062839248 10:657479-657501 CAGGTCCAGCGGCAGGTCCAGGG - Intronic
1062839269 10:657563-657585 CAGGTCCAGGGGCAGGTCCAGGG - Intronic
1062839274 10:657575-657597 CAGGTCCAGCGGCAGGTCCAGGG - Intronic
1062839289 10:657635-657657 CAGGTCCAGGGGCAGGTCCAGGG - Intronic
1062839294 10:657647-657669 CAGGTCCAGGGACAGGTCCAGGG - Intronic
1062839298 10:657659-657681 CAGGTCCAGCGGCAGGTCCAGGG - Intronic
1062839310 10:657707-657729 CAGGTCCAGGGGCAGGTCCAGGG - Intronic
1062839315 10:657719-657741 CAGGTCCAGCGGCAGGTCCAGGG - Intronic
1062839338 10:657827-657849 CAGGTCCAGGGGCAGGTCCAGGG - Intronic
1062839343 10:657839-657861 CAGGTCCAGCGGCAGGTCCAGGG - Intronic
1062839352 10:657875-657897 CAGGTCCAGGGGCAGGTCCAGGG - Intronic
1062839357 10:657887-657909 CAGGTCCAGCGGCAGGTCCAGGG - Intronic
1062839367 10:657923-657945 CAGGTCCAGGGGCAGGTCCAGGG - Intronic
1062839372 10:657935-657957 CAGGTCCAGGGGCAGGTCCAGGG - Intronic
1062839377 10:657947-657969 CAGGTCCAGGGACAGGTCCAGGG - Intronic
1062839381 10:657959-657981 CAGGTCCAGCGGCAGGTCCAGGG - Intronic
1062839394 10:658007-658029 CAGGTCCAGGGGCAGGTCCAGGG - Intronic
1062839399 10:658019-658041 CAGGTCCAAGGGCAGGTCCAGGG - Intronic
1062839404 10:658031-658053 CAGGTCCAGGGACAGGTCCAAGG - Intronic
1062839407 10:658043-658065 CAGGTCCAGGGACAGGTCCAGGG - Intronic
1062839421 10:658103-658125 CAGGTCCAGGGGCAGGTCCAGGG - Intronic
1062839426 10:658115-658137 CAGGTCCAGCGGCAGGTCCAGGG - Intronic
1062839448 10:658199-658221 CAGGTCCAGGGGCAGGTCCAGGG - Intronic
1062839453 10:658211-658233 CAGGTCCAGCGGCAGGTCCAGGG - Intronic
1062839468 10:658271-658293 CAGGTCCAGGGGCAGGTCCAGGG - Intronic
1062839473 10:658283-658305 CAGGTCCAGGGACAGGTCCAGGG - Intronic
1062839477 10:658295-658317 CAGGTCCAGCGGCAGGTCCAGGG - Intronic
1062839489 10:658343-658365 CAGGTCCAGGGGCAGGTCCAGGG - Intronic
1062839494 10:658355-658377 CAGGTCCAGCGGCAGGTCCAGGG - Intronic
1063177669 10:3566917-3566939 CAGTTCCAGCAGCTGGTCCTTGG - Intergenic
1067180664 10:43983510-43983532 CAGTTCCAGGAGCTGGGCCTTGG + Intergenic
1067522784 10:47020761-47020783 TACTCCCAAGGGCTGGCCCAGGG + Intergenic
1069863149 10:71483645-71483667 CCGTCCTAAGGGCTGGTCCCTGG + Intronic
1070769245 10:79072734-79072756 CAGTGACAGGGGCTGGGCCAGGG - Intronic
1070810007 10:79292954-79292976 CAGGACCAAGGGCAGGGCCAGGG + Intronic
1072410827 10:95200656-95200678 CAATTCTATGGGCTGCTCCAGGG + Intronic
1075552890 10:123406123-123406145 CAGTTCCAGGGGCTGATAGAGGG + Intergenic
1075897353 10:126008639-126008661 CAAACCCAAGGGCTGGTGCAGGG - Intronic
1076483063 10:130797385-130797407 CAGTTCCAGGGCTTAGTCCAAGG + Intergenic
1076754604 10:132562762-132562784 CAGAGCCAAGGTCTGGTCCTGGG - Intronic
1077046925 11:550886-550908 CAGACCCAAGGCCGGGTCCAGGG - Intronic
1077458336 11:2694287-2694309 CAGTCCCAAGAGCTGTTCTAAGG + Intronic
1078315378 11:10289585-10289607 CACTCCCAAGGGCTGGGCCCAGG - Intronic
1078660596 11:13282541-13282563 CTGGGCCAAGGGCTGGTACAGGG - Intronic
1079835222 11:25325699-25325721 CTGTTCCTAGGGCTGGTCTCAGG + Intergenic
1080557666 11:33431870-33431892 CAGTCCCAAGGACTGCCCCACGG + Intergenic
1081032703 11:38106620-38106642 CAGATACAAGGGCTTATCCAAGG - Intergenic
1081070372 11:38603184-38603206 CAGTTCTAAGGCCCTGTCCATGG - Intergenic
1082881317 11:58041091-58041113 CAGTTCCAAGAGAAGTTCCAAGG + Intronic
1083203682 11:61134714-61134736 CAGTGGCATGGTCTGGTCCAGGG - Intronic
1084108775 11:66999226-66999248 GAGTTCCAAGGGATGGGCCAAGG - Intergenic
1084929157 11:72540317-72540339 CAGTCCCAAGGCCAGGTCCTGGG + Intergenic
1085049285 11:73371865-73371887 CCCTTCCCAGGGCTGGTCTAAGG - Intergenic
1088720327 11:112586558-112586580 CAGTTCCATTGGCTGCTCCATGG + Intergenic
1088904844 11:114147234-114147256 GAGTTTCCATGGCTGGTCCATGG + Intronic
1089712071 11:120322600-120322622 ATGTTCCAAGGGCTGGGCCAGGG + Intergenic
1091838035 12:3599695-3599717 CAGTTGGAAGGGTTGGTGCAAGG + Intergenic
1092486557 12:8907351-8907373 AAGTCCCAAGGTCTGCTCCATGG + Intergenic
1092764286 12:11838770-11838792 CAGTTCCAGGGGCTGTTCCAGGG - Intronic
1093757466 12:22868376-22868398 GAGTTCCAAGGGCTGAGCCATGG - Intergenic
1095538642 12:43281802-43281824 CAGTTCAGTGGGCTGGTTCATGG + Intergenic
1095825911 12:46530755-46530777 CACTCCCAATGGCTGGGCCAGGG + Intergenic
1099043690 12:77688467-77688489 CATTTCCAAGGCCTAGTCTAGGG + Intergenic
1100368685 12:93944789-93944811 CAGTTCCAAGGACTCATACAAGG - Intergenic
1100689029 12:97019174-97019196 CAGTCCTGAGGGCTGGCCCAGGG + Intergenic
1100969103 12:100047587-100047609 CAGTTACAGGAGCTGGTTCAAGG + Exonic
1103271275 12:119675802-119675824 CAGATCCTGGGACTGGTCCAGGG - Intronic
1104966192 12:132509730-132509752 CAGTGACACGGGCTGGCCCACGG - Intronic
1105738921 13:23301452-23301474 CTGATCCCAGGGCTGGGCCAGGG + Intronic
1106796977 13:33216911-33216933 GTGTTCCAAGGGATGGGCCAGGG - Intronic
1109655712 13:65387942-65387964 TGGTTTCAAGGGCTGGCCCAGGG + Intergenic
1113318673 13:109210822-109210844 CAGTTCCAAGTGACGGTCAATGG - Intergenic
1114443709 14:22771636-22771658 CAGTTCCTAGGACTGGGGCAAGG - Exonic
1116761359 14:49019163-49019185 CAGTTTCAAGAGCTGATCTAGGG + Intergenic
1117733807 14:58750123-58750145 CAGTTCCTTGGGCTGGCTCAGGG - Intergenic
1119386441 14:74260439-74260461 CAAGTCCCAGGGCTGGACCAGGG - Intronic
1121270318 14:92633287-92633309 CAGTGCCCAGGGCTGTGCCAGGG - Intronic
1121937840 14:98036883-98036905 TAGTTCCATGGGCTCTTCCAAGG - Intergenic
1122059095 14:99124698-99124720 CACCTCCAAGGCCTGGCCCAGGG - Intergenic
1122363327 14:101180244-101180266 CGGTCCCAAGGGCTGGGACATGG - Intergenic
1122950565 14:105042270-105042292 CAGTTCCAGGGGCTGGCGCAGGG - Intergenic
1124662061 15:31557937-31557959 CACTTCCAAGGCTTGGTCCGTGG - Intronic
1125752177 15:42036583-42036605 CACTCCCAAAGGCTGGGCCAGGG + Intronic
1126097104 15:45097580-45097602 CTGCTCCATGGGCTGGCCCAGGG + Intronic
1126420729 15:48469601-48469623 CAGATCCAAGGGGAGGACCAAGG - Intronic
1126852066 15:52803722-52803744 CACTTCCCTGGGCTGGTTCACGG - Intergenic
1126876501 15:53047444-53047466 CAGTTGCCAGGGCTGGTGGAGGG - Intergenic
1128074932 15:64820071-64820093 CAGTCCCAAGGCCTGACCCATGG - Intronic
1128576079 15:68775993-68776015 CCTATCCAAGGGCTGGACCAGGG + Intergenic
1129656751 15:77529678-77529700 CAGGCCCAAGGGCTTGTCCATGG - Intergenic
1130693475 15:86106463-86106485 CAATTCCAGTGGCTGTTCCAGGG + Intergenic
1130833865 15:87630440-87630462 CCGTTCCAATGATTGGTCCAGGG - Intergenic
1132653613 16:1032383-1032405 CAGGTCCAAGGGCAGAGCCAGGG + Intergenic
1132945846 16:2531148-2531170 CAGGCCCAAAGGCTGGCCCAGGG - Exonic
1134105881 16:11485780-11485802 CATTGCCAAGGGCTGGTCTCTGG - Intronic
1135400885 16:22165680-22165702 CAGGTCCAAGGTCTGGCTCAGGG + Intergenic
1135994912 16:27240495-27240517 CAGTGCTCAGGGCTGGGCCAAGG - Intronic
1136281741 16:29217535-29217557 CAGTACCAAGGGCTGGACGCTGG + Intergenic
1138086189 16:54135735-54135757 CAGTTCCAAGGACAGGTCTTTGG - Intergenic
1139477034 16:67207937-67207959 CAGTGACAAGGGCTGGGCCCAGG - Exonic
1140325119 16:73993972-73993994 CAGTTTAAATAGCTGGTCCAAGG - Intergenic
1141551413 16:84809044-84809066 CAGAGCTAAGGGCTGGCCCATGG - Intergenic
1143610270 17:8014006-8014028 CAGGTCGAAGGTGTGGTCCATGG - Exonic
1144869760 17:18362201-18362223 CAGTTCCAAGGCCTTGTCCCAGG + Intronic
1145779670 17:27553922-27553944 CAGCTGCAAGGGCTGGCCCCAGG + Intronic
1146122577 17:30208492-30208514 CAGTTCCTAGGGCAGGTCTATGG + Intronic
1147254905 17:39175619-39175641 CCGTTCCAGTGGCTGGTCCCCGG + Exonic
1148679852 17:49467325-49467347 CCTTTCCCAGGGCTGGTCCAGGG - Intronic
1150591602 17:66567501-66567523 CAGCATCAAGGGCTGGTACAAGG - Intronic
1152313656 17:79566818-79566840 CAGTTACAATGGCTGGGCCCTGG + Intergenic
1152686003 17:81694157-81694179 CAGTCCCAAGGGCCGAACCAGGG - Intronic
1152942188 17:83178520-83178542 CAGGTTCAGGGGCTGGCCCAAGG - Intergenic
1156377289 18:36526142-36526164 GAGATCCAAGGGCTCGGCCAAGG + Intronic
1159003517 18:62993047-62993069 CCATTCCAAGGGATGGGCCAGGG + Intergenic
1160607115 18:80059425-80059447 CAGTGCTGAGGGCTGGACCATGG + Intronic
1160749247 19:726257-726279 CAGGTCCTAGGACAGGTCCAGGG - Intronic
1162345355 19:10115265-10115287 CAGTCTCCAGGCCTGGTCCACGG + Exonic
1163045518 19:14638648-14638670 CAGTCCCAAGGGCAGGTTGAAGG - Intronic
1164051543 19:21588324-21588346 CAATTGCAGGGGCTGGTCCAAGG + Intergenic
1164502664 19:28832666-28832688 GGGTTCCAAGGGATGGGCCAGGG + Intergenic
1164536535 19:29089965-29089987 CAGCACCAAAGGCTGGACCACGG - Intergenic
1165266182 19:34665062-34665084 CAGGGCCCAGGGCAGGTCCAGGG - Intronic
1165273810 19:34732120-34732142 CAGGGCCCAGGGCAGGTCCAGGG - Intergenic
1165708548 19:37993268-37993290 CTGTGCCAAGAGCTGGTTCAAGG - Intronic
1166313829 19:41977798-41977820 CAGACCCAGGGCCTGGTCCATGG + Intronic
1167345389 19:48942469-48942491 CAGTACCCAGGGGAGGTCCATGG + Exonic
1168134203 19:54339267-54339289 CATTTCCCAGGGCTTGTCCTGGG + Intergenic
925712308 2:6753244-6753266 CAGATCCAAGGGCCTGTCCAAGG + Intergenic
925991536 2:9259072-9259094 CCGTCCCACGGGCTGGACCACGG - Intronic
926170575 2:10550436-10550458 CTGTTCCAAGGTCTGCCCCAGGG - Intergenic
926705599 2:15835252-15835274 CATTTCCTAGGGCTGCTCAATGG + Intergenic
927497898 2:23563047-23563069 GCCTTCTAAGGGCTGGTCCAAGG + Intronic
928500126 2:31882556-31882578 CAGGTCAAACTGCTGGTCCAAGG + Intronic
929054955 2:37868723-37868745 CAGTTCCAAAGGCTAGTGAAGGG - Intergenic
931005264 2:57843478-57843500 CAGTTCAGTGGGCTTGTCCATGG - Intergenic
931417699 2:62097232-62097254 GTATTCCAAGGGCTGGTGCAGGG + Intronic
932214223 2:69956015-69956037 CTGATCCCAGGGCTGGTACAGGG + Intergenic
932240197 2:70150386-70150408 CAGTTCCAAGGGCTGGTCCAAGG + Exonic
932481184 2:72040328-72040350 CAGTTCCATCTGCAGGTCCATGG - Intergenic
932879039 2:75482996-75483018 CAGTTCCAAGGGGTGGTCACTGG + Intronic
933157380 2:78991290-78991312 CAGTTGCAAGGGATGGTCCAGGG + Intergenic
937349253 2:121150070-121150092 CAGCCCCAAGGGGTGGGCCAGGG - Intergenic
937648241 2:124290086-124290108 CAGTTCCAAGGGGAAGTCGAGGG - Intronic
941641328 2:167991861-167991883 CTGTTCCAAGGTCTTGTCTAAGG + Intronic
945094591 2:206207019-206207041 CAGTCAGAAGTGCTGGTCCAAGG - Intronic
947792059 2:232873992-232874014 CATTCCCCAGGGCTGGCCCAAGG - Intronic
1171344073 20:24452543-24452565 GAGTTCCAGTGGCTGTTCCATGG - Intergenic
1172248044 20:33459566-33459588 CAGTACCAAGGACAGGACCAGGG - Intergenic
1173089382 20:39955717-39955739 CAGAGCCAAGGGCTGATTCAGGG - Intergenic
1173822871 20:46030193-46030215 CAGTTCCCTGGGGCGGTCCAGGG + Intronic
1173950625 20:46990411-46990433 CACATCCAAGGGCTGGGCCTGGG - Intronic
1175263137 20:57687270-57687292 CTGTGCCTGGGGCTGGTCCAAGG + Intronic
1176301398 21:5100710-5100732 CGGTCCCAGGGGCTGGGCCAGGG + Intergenic
1179722017 21:43321496-43321518 CAGTTCCAAGGGCAGTGCCTGGG - Intergenic
1179855633 21:44161189-44161211 CGGTCCCAGGGGCTGGGCCAGGG - Intergenic
1183407786 22:37639104-37639126 GAGTTCCAGGGGCTTGTCCACGG + Intronic
1184381336 22:44146791-44146813 CAGCTCCCAGGGCTGCTCCTTGG + Intronic
1184457949 22:44622063-44622085 CAGATCCCAGGGCTGGGCCGTGG + Intergenic
1184779609 22:46640523-46640545 GAGTCACAAGTGCTGGTCCAGGG - Intronic
1184865295 22:47198858-47198880 GGGCTCCAAGGGCTGGTGCATGG + Intergenic
1185106090 22:48870704-48870726 CAGGGCCAAGGGCTGTGCCAGGG + Intergenic
950455798 3:13092006-13092028 CAGTTCTAAGGGCCTGTGCATGG + Intergenic
951895864 3:27609208-27609230 CCGTTCTTAGGGCTGGTCCTGGG - Intergenic
953390867 3:42532961-42532983 CCTTTCCAAGCCCTGGTCCATGG - Intronic
954096763 3:48334903-48334925 CAGTTCTAAGGGCCTGGCCAAGG + Intergenic
954453473 3:50584276-50584298 CAGTTCAGGGGGCTTGTCCAGGG - Exonic
956582595 3:70830949-70830971 AAGTTTCTAGGGCTGGACCATGG - Intergenic
958548696 3:95589233-95589255 AAGTTCCAGGGGACGGTCCAGGG + Intergenic
958952027 3:100427137-100427159 CAGTTCCAAGAGCTAGAACAAGG - Intronic
959867315 3:111285754-111285776 CAGTTCCCAGGGCTTGCCCCAGG - Intergenic
960620321 3:119630769-119630791 CATTTCCAAGGCCTGGACAAAGG - Intergenic
960698733 3:120420112-120420134 CAGTTCCAAGGGCTGGCACAGGG + Intronic
961305975 3:125959301-125959323 CAGTGACACGGGCTGGCCCACGG - Intergenic
966276158 3:178172570-178172592 CTGTTCCAGTGGATGGTCCATGG + Intergenic
967540711 3:190664541-190664563 CACTTCCAAGGGCAGGTACATGG + Intergenic
969293364 4:6254526-6254548 CATTCCCATGGGCAGGTCCAGGG + Intergenic
969457152 4:7306638-7306660 CAGTTCCCAAAGCTGGTCCTGGG + Intronic
975202199 4:71604729-71604751 CAGTTCCTAGGACTGTTCTAAGG - Intergenic
975426257 4:74231357-74231379 AAGTTCCAAGGGGTGGGGCAAGG + Intronic
976259921 4:83135725-83135747 CAGTTTCATGGGCTGGGCCCAGG - Intronic
976637572 4:87302307-87302329 CAGTTCCAAGGGCTACTGCTAGG - Intergenic
981983875 4:150830170-150830192 CAGATTCAAGGGCTTGTCAAGGG - Intronic
982627042 4:157780517-157780539 AAGCTCAAAGAGCTGGTCCAGGG + Intergenic
984612841 4:181859993-181860015 GAGTTCCCAGGGATGGTCTAAGG - Intergenic
985846950 5:2356929-2356951 CACTTCCCAGGGCTGTGCCAAGG + Intergenic
986171330 5:5317115-5317137 CAGTGACAAGGGCTGGTCCTGGG + Intronic
990791328 5:59483456-59483478 CAGTTCCAAGGACCTGCCCAGGG + Intronic
994028581 5:95114388-95114410 CTGTCCCAAGGGCAGGTCGAAGG - Intronic
997416471 5:133732479-133732501 CTGTTCCTAGGGCTGGACTAGGG - Intergenic
997661625 5:135593568-135593590 AAGTTCCAAGGGCTTCTCCCAGG + Intergenic
997969664 5:138390863-138390885 CAGTTACAAGAGCAGATCCATGG + Intronic
998863528 5:146470962-146470984 CAGGTCCAAGCTCTGGTCCAAGG - Intronic
1004086922 6:12458651-12458673 CAGAGCCAGGGGCTGCTCCATGG - Intergenic
1005926460 6:30449554-30449576 CAGTGCCAAGGGCTTGTCCTGGG - Intergenic
1005928181 6:30462126-30462148 CAGTGCCAAGGGCTTGTCCTGGG - Intergenic
1008888506 6:56457796-56457818 CACTTACAATGGCTGGTGCATGG + Intergenic
1011158074 6:84355934-84355956 CAGGTGCAGGGGCTGGGCCAAGG - Intergenic
1012517753 6:100082215-100082237 CAGTTCTATGGACTGGTACAAGG - Intergenic
1013015822 6:106159789-106159811 CAGTGCCAAGTGCTGGCCCATGG + Intergenic
1013627735 6:111954284-111954306 CAGTTCAAAGGGCCGGTGTAGGG + Intergenic
1014292573 6:119575987-119576009 CATTTCCAAGGGCTTCTCAAAGG + Intergenic
1017992611 6:159504512-159504534 CACTTCCCAGGGCTGCTCCCAGG - Intergenic
1018413444 6:163579700-163579722 CAGGTGCAAGGGCTCGGCCAAGG + Intergenic
1018682015 6:166272131-166272153 GCGCTCCAAGGGCTGGGCCAGGG + Intergenic
1018776566 6:167022858-167022880 CACTTGCCAGGGCTGTTCCAGGG + Intronic
1019158016 6:170051871-170051893 GAGCTCCAAGGGCGGGTCCAGGG - Intergenic
1022086092 7:27069056-27069078 GAGTTCCATGGGCAGTTCCATGG - Intergenic
1022528783 7:31054155-31054177 CAGTTGGAAGAGCTGGCCCAGGG - Intronic
1023528020 7:41125598-41125620 CAGTTCCAAGAGCTGGGATATGG + Intergenic
1024222885 7:47302207-47302229 CACTTCCAAGTTCTGGTACAAGG - Exonic
1024517223 7:50269175-50269197 CAGTTAGGAGGGCTGTTCCATGG + Intergenic
1027350821 7:77309309-77309331 CAGCTCCATGGGCTGCTCCCAGG - Intronic
1027434579 7:78151430-78151452 CGGTTCCAAGGGTTGGTTCCAGG + Intronic
1028066602 7:86392048-86392070 CGGTTTCATGGGCTGGGCCAAGG - Intergenic
1029255781 7:99268558-99268580 CAGTTCCAGGGGAAGGCCCAGGG + Intergenic
1033755721 7:144397282-144397304 CAGTGCTGAGGGCTGATCCAGGG + Exonic
1034042442 7:147893784-147893806 CACTTCCAAGATCTGGGCCATGG - Intronic
1034336916 7:150329847-150329869 GAGTTCCAAGGGCTGATGCTGGG + Exonic
1035232050 7:157471011-157471033 CAGCTCCACGGGCACGTCCAAGG - Intergenic
1037374992 8:18217829-18217851 CTGTTGCAGGGGCTGGTGCAGGG + Intronic
1042665420 8:71199352-71199374 CAGTTCCAAGGCATGGTGCAGGG + Exonic
1045036045 8:98177169-98177191 CAGTGCCAAGTGCTGGGGCAGGG - Intergenic
1045298037 8:100889310-100889332 CAACTCCAGGGGCTGGCCCAGGG + Intergenic
1045360878 8:101432192-101432214 TAGTTCCAATGGCTGGACCCGGG + Intergenic
1046175590 8:110571187-110571209 TAGTTTCATGGGCTGGGCCAGGG - Intergenic
1047497164 8:125416696-125416718 ACGTTCCAGGGGCTGGTCCATGG + Intergenic
1048292854 8:133193781-133193803 CATTACCAAGAGCTGGACCAAGG - Intronic
1048943848 8:139426636-139426658 CAGTTTCCAAGCCTGGTCCATGG - Intergenic
1048996999 8:139800663-139800685 GAGGTCCCAGAGCTGGTCCATGG + Intronic
1050816355 9:9817993-9818015 CAATTCCAAGGGCTGATCTTGGG + Intronic
1051160807 9:14205174-14205196 GAGTTCCAAGGGCTGACCAAAGG + Intronic
1051593393 9:18799066-18799088 GAGTTCCATGGGCTGTTCCAGGG - Intronic
1055315335 9:75028526-75028548 CGCTTCCAAGGGCGGGGCCAAGG + Intergenic
1058094441 9:100843616-100843638 CAACTTCAAGAGCTGGTCCAAGG - Intergenic
1058644857 9:107121580-107121602 CAGTGCCAAGGCGTGTTCCATGG - Intergenic
1059706107 9:116825093-116825115 TAGTTTCAAGGACTTGTCCAAGG - Intronic
1060520399 9:124290899-124290921 CAGTTCCAGGGCCTGCTCCTGGG + Intronic
1061813619 9:133179383-133179405 CTGTTACAAGGGCTGGTGCACGG + Intergenic
1061862012 9:133473021-133473043 CAGTGCCAGGGGCTGTGCCAAGG - Intronic
1186473190 X:9837060-9837082 CGGTGCCAAGTGCTGGTCCTTGG + Intronic
1189297682 X:39930275-39930297 CAGCTCAAAGGGAAGGTCCAGGG + Intergenic
1190098293 X:47500384-47500406 CAGTTCCCAGGGCTGGAGCAAGG + Intergenic
1191773202 X:64784784-64784806 GAATTCCAAGGGCTGGTTGATGG + Intergenic
1194387393 X:93273265-93273287 GAGTTCAAAAGGCGGGTCCAGGG + Intergenic
1195758885 X:108225215-108225237 CAGTCCCAGGGGCGGGCCCAGGG - Intronic
1195789072 X:108561336-108561358 CAGATCCATGAGCTGATCCATGG - Intronic
1197822216 X:130552860-130552882 CAGTTCCAAAGGGAGGTCCCCGG + Intergenic
1198880218 X:141272929-141272951 CATTTCCAAGGGCTGACCAAGGG + Intergenic
1199585075 X:149406068-149406090 CAGCACCAAGGGCTAGGCCAGGG + Intergenic
1200294651 X:154906882-154906904 GAGATCCAAGGGCTTGACCATGG - Intronic
1200972239 Y:9164924-9164946 CAGTTCCAGGTGCTGGCACAGGG - Intergenic
1201337728 Y:12898308-12898330 CTTTTCCTGGGGCTGGTCCAAGG - Intergenic
1202113917 Y:21451868-21451890 CAGTTTAAAAGGCTAGTCCAAGG + Intergenic
1202138784 Y:21699360-21699382 CAGTTCCAGGTGCTGGCACAGGG + Intergenic