ID: 932242042

View in Genome Browser
Species Human (GRCh38)
Location 2:70164771-70164793
Sequence GCTGCCTGCCAGTCAAATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 144}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932242041_932242042 28 Left 932242041 2:70164720-70164742 CCACTGACTTCACAAATATTATA 0: 1
1: 0
2: 3
3: 34
4: 327
Right 932242042 2:70164771-70164793 GCTGCCTGCCAGTCAAATCTAGG 0: 1
1: 0
2: 1
3: 6
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932242042 Original CRISPR GCTGCCTGCCAGTCAAATCT AGG Intronic
900149874 1:1173698-1173720 GCTGCCTCCCAGTCACTGCTGGG - Intergenic
903586005 1:24415722-24415744 ACTGCCTGCCAGTCAGAAGTTGG - Intronic
907815664 1:57916156-57916178 CCTCCCTGACAGTGAAATCTGGG + Intronic
910136462 1:83977564-83977586 GATGTCTGCCAGTCAACTCATGG - Intronic
911010965 1:93280360-93280382 TCTGCCTGCCTGTAAAATATTGG - Intergenic
911213283 1:95165091-95165113 GCTCCCTGTCATTCCAATCTTGG + Intronic
913448093 1:118971336-118971358 GGTGCCTGCCAGTCACCTGTAGG - Intronic
919929280 1:202210617-202210639 GCTGCCAGCCAGTCAGCTCGTGG + Intronic
920563142 1:206953363-206953385 GCTGCCTGTCAGGCAAGCCTTGG - Intergenic
920713530 1:208317844-208317866 GCTGCCTTCCAGTCAGAATTGGG + Intergenic
922807352 1:228397263-228397285 GCTGCCTGACGCTCAAATGTAGG - Intronic
922959731 1:229636125-229636147 GCTGCCTCCAAGTCAGATCCTGG + Exonic
923366092 1:233263389-233263411 CCTGCCTGCAAATCAAATGTTGG - Intronic
1068844373 10:61655319-61655341 GCAGCCTTCCCATCAAATCTTGG - Intergenic
1072785288 10:98275325-98275347 CCTGCCTGCCAGACAGGTCTGGG - Intergenic
1073107870 10:101042852-101042874 GGTCCCTGTCAGTCAAAGCTAGG + Intergenic
1077352288 11:2098586-2098608 CCTTCCTGCCTCTCAAATCTGGG - Intergenic
1080837198 11:35950166-35950188 GCTCTCTGCCAGTGTAATCTCGG + Intronic
1080846056 11:36027992-36028014 GCTGGCTGCCGGTCAGACCTGGG - Intronic
1081768247 11:45627975-45627997 GCTGCCTGGCAGTTCGATCTTGG - Intergenic
1083795928 11:65016686-65016708 GCTGCCTGCCTGACACTTCTGGG - Intronic
1085303241 11:75471078-75471100 GCCACCTGCAAGCCAAATCTTGG + Intronic
1085509824 11:77082594-77082616 CCTGCCTGCCAGGCTAACCTTGG - Intronic
1089689737 11:120179862-120179884 GCTGCCTGGCTGTGCAATCTTGG - Intronic
1090216303 11:124968388-124968410 GCTGCCTCGCAGTTTAATCTCGG + Intronic
1093433014 12:19105203-19105225 GCTGCCTTCCTGTCATAACTGGG - Intergenic
1096258639 12:50077633-50077655 GCTGCCTGCCTGTCTGGTCTCGG + Intronic
1098946112 12:76591637-76591659 GCTTTCTGCCAGTAAAATTTTGG - Intergenic
1099067155 12:77995985-77996007 TCTGCCTGCCTGTCAAATTAGGG + Intronic
1099086985 12:78257869-78257891 GCTGCCTTGCAGTTCAATCTTGG + Intergenic
1099442651 12:82716678-82716700 GCTGAGTGCCAGTTAAATGTAGG + Intronic
1101978606 12:109385147-109385169 GCTTCCTGGCAGTATAATCTTGG - Intronic
1105383777 13:19911609-19911631 GTGGCCTGCCAGTCAAATTGTGG + Intergenic
1113468006 13:110525511-110525533 GCTCCCTGCCAGTCCACTCAAGG + Intronic
1114654322 14:24307050-24307072 ACTTCCTGCCTGTCAAACCTTGG - Exonic
1115024545 14:28727525-28727547 ACTGCATGCCAGTCAGATTTAGG + Intergenic
1116593000 14:46804046-46804068 GCTTCCTGCTGGTCAAATTTTGG - Intergenic
1118136931 14:63039857-63039879 ACTCCCTCCCAGTCAAATTTGGG + Intronic
1121031692 14:90663826-90663848 GCTGCCTGCCAGTGGGCTCTTGG + Intronic
1121567335 14:94919984-94920006 GCTGCCTGCCAGCCACATCTTGG - Intergenic
1122643311 14:103175213-103175235 GCTGTCTGCCAGTGGAACCTGGG - Intergenic
1125306815 15:38326754-38326776 GCTTCCTGCCAGTGGAATTTTGG - Intronic
1127870106 15:63065140-63065162 ACTGCCTAACAGTAAAATCTGGG - Intronic
1128067240 15:64773100-64773122 GCTTCTTCCCAGTCAACTCTTGG - Intronic
1133533415 16:6676319-6676341 CCTGCCTTCCAGTCAATTTTGGG + Intronic
1134807757 16:17140124-17140146 GCTGCCTGCCGGTCAGAGCTGGG - Intronic
1135916998 16:26614265-26614287 CCTGCCTGCCTGCCAACTCTAGG + Intergenic
1137576880 16:49605760-49605782 GCTGCCTGCCAGTGACAACGGGG - Intronic
1147185252 17:38709879-38709901 GCTGCCTCCCACACAAATGTTGG - Intronic
1152139596 17:78528675-78528697 GCTGCCTCCCAGCCACGTCTAGG - Intronic
1154500362 18:14992979-14993001 GCTGCCTGCCAGGCAAAAGAGGG + Intergenic
1160794533 19:938788-938810 GGTGCCTGCCAGGCAGCTCTCGG + Intronic
927026682 2:19075281-19075303 CCTGCCTGGAAGTCAAATCCCGG + Intergenic
929779409 2:44948285-44948307 GCAGCCTGGCAGTCATATCTAGG - Intergenic
932242042 2:70164771-70164793 GCTGCCTGCCAGTCAAATCTAGG + Intronic
937288091 2:120765618-120765640 CCTGCCTGCCAGTGACACCTTGG + Intronic
938499565 2:131823324-131823346 GCTGCCTGCCAGGCAAAAGAGGG + Intergenic
942946298 2:181678282-181678304 GCTGCCTGCAACTCAATCCTCGG - Exonic
944140234 2:196448340-196448362 CCTGTCTGGAAGTCAAATCTAGG - Intronic
944877044 2:203972824-203972846 CCTGCCTTCCAGTCGAAGCTTGG + Intergenic
945434615 2:209804441-209804463 GCTTCCTGCCAGTAAAGTTTTGG + Intronic
946209896 2:218139083-218139105 GCTGCCTGCCAGCCAAGAATAGG - Intergenic
947852337 2:233298507-233298529 GATGCCTGCCAGTGAAAGATAGG + Intergenic
947917471 2:233842973-233842995 GCTCCCTGACAGCTAAATCTGGG + Intronic
1171247462 20:23623501-23623523 CCTGCCTGCCTGACAAATCCTGG + Intergenic
1171273638 20:23835841-23835863 GCTGCCTCACAGTTCAATCTTGG - Intergenic
1172892905 20:38279603-38279625 TCTTCCTGCCACACAAATCTGGG - Intronic
1178100944 21:29267886-29267908 TCTGCTTGCCAGTCACAGCTGGG + Intronic
1178367647 21:32000701-32000723 GCTGCCTGCCAGGGAAATAAAGG - Exonic
1179385771 21:40940710-40940732 GCTTCCTGCCAGTAGAATTTGGG - Intergenic
1180675782 22:17585453-17585475 GCTGGATACCAATCAAATCTGGG + Intronic
1180897570 22:19348101-19348123 GCTGCCTGGAACTCAAAGCTGGG - Intronic
1182486377 22:30641445-30641467 GCTGCCTGCCAGACAGATTTGGG + Intronic
1182783482 22:32886861-32886883 GCTGCCTTCCAGTCCATACTTGG - Intronic
1184379539 22:44136474-44136496 GCTGCATTCCAGCCACATCTCGG + Exonic
1184599501 22:45534358-45534380 GCTGCCTTCCATCCAAATCCAGG + Intronic
951617745 3:24567115-24567137 GCTGCCTTGCAGTTCAATCTCGG - Intergenic
953934136 3:47025103-47025125 GCTGCTAGGCAGGCAAATCTGGG - Intronic
954303804 3:49715076-49715098 GCTGCCTGCCAGCCCAGACTTGG + Intronic
954322146 3:49839612-49839634 GCTGCTTGCCAGCTAAATCTTGG + Intronic
954827946 3:53391531-53391553 GCCGCCTGGCAGTTCAATCTTGG - Intergenic
955133067 3:56189693-56189715 GGTGCCTGCAAGCCAAATGTTGG - Intronic
960956464 3:123034914-123034936 GCTGCCTCCCACTCAAATCAGGG - Intergenic
962973406 3:140425456-140425478 GCTGCCTGCCTTTCAGACCTTGG + Intronic
965102793 3:164322946-164322968 GATTCCTGCTGGTCAAATCTGGG + Intergenic
966494129 3:180560309-180560331 GCTGCCTTGCAGTTCAATCTCGG - Intergenic
973386122 4:49515380-49515402 GCTGACTCCCACTGAAATCTGGG - Intergenic
973705945 4:53580458-53580480 GCTGTCTGGCAGTCACATCAAGG - Intronic
975018894 4:69462650-69462672 TCTTCCTGCCAGACAAAACTTGG + Intergenic
980245705 4:130238375-130238397 GATGCCTGCCAGACAATCCTAGG + Intergenic
982576623 4:157119479-157119501 GCAACCTGCCATTGAAATCTAGG - Intronic
984434031 4:179685416-179685438 GCTGCCTCGCAGTTCAATCTTGG + Intergenic
989315146 5:40069789-40069811 GCTGCTTGTTAGTCAGATCTCGG + Intergenic
990992892 5:61702344-61702366 ACTGCCTGTCAGACAAATCAGGG - Intronic
992480399 5:77145803-77145825 GCTTCCTGCCAGTAGAATTTTGG - Intergenic
995542931 5:113201998-113202020 GCTGGCAGCCAGTAAAAACTGGG - Intronic
996338630 5:122412054-122412076 CCTGCCTGCCAGTCACGTCAAGG + Intronic
997208106 5:132062123-132062145 CCTGCCTGCCACTCACTTCTAGG + Intronic
998095908 5:139395321-139395343 CCTGCCTGTCAGCCAAAGCTTGG - Exonic
999303413 5:150504902-150504924 TCTGCCTCCCAGTCCAAGCTTGG - Intronic
999531373 5:152466734-152466756 TCTTCCTGCCAGTGGAATCTGGG - Intergenic
999772177 5:154784000-154784022 GTTGCCTGTGAGTCAAAGCTGGG + Intronic
1003068349 6:2921904-2921926 GGTTCCAGCCAGTCCAATCTAGG - Intergenic
1004842444 6:19602753-19602775 GCTGACTGACAGTCCAAGCTGGG - Intergenic
1007360072 6:41348675-41348697 GCTTCCTGCCAGTTTAATTTGGG + Intronic
1008842380 6:55919574-55919596 TCTGCCTGCCAGACAAACCTGGG - Intergenic
1009384858 6:63076025-63076047 GCTGCCTCACAGTTCAATCTTGG + Intergenic
1010629496 6:78180539-78180561 GCTGCCTACCAGTCACATACTGG + Intergenic
1011139122 6:84133590-84133612 GCTGCCTTGCAGTTCAATCTCGG + Intronic
1011524927 6:88253998-88254020 GCTGCCTTGCAGTTAGATCTTGG - Intergenic
1013634214 6:112013125-112013147 GCTGACTTATAGTCAAATCTTGG - Intergenic
1016152377 6:140757795-140757817 GCTGCCTCCCAGTTAAAAATGGG - Intergenic
1016551662 6:145287097-145287119 GCTGCCTGCCATTCACTTCAGGG - Intergenic
1016897178 6:149064929-149064951 ATTGCCTGCCAGTCCGATCTTGG + Intronic
1019216062 6:170444640-170444662 GATGCCTGGCTGTCAAAGCTGGG + Intergenic
1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG + Intronic
1019391277 7:787953-787975 GCTCCCTGCCATTCATTTCTGGG - Intergenic
1022273766 7:28836301-28836323 GCAGCCTGCCTCTCAAATCCTGG + Intergenic
1023232553 7:38050060-38050082 GCTGCCTGCCAGTCCCATGCAGG - Intergenic
1024714552 7:52061147-52061169 GCTGCCTCTCAGTCATCTCTTGG - Intergenic
1025964699 7:66257527-66257549 GCTTCCTGCCAGTAGAATTTTGG + Intronic
1026289602 7:68994491-68994513 GCTACCTACCAGTCATATCCAGG + Intergenic
1035025015 7:155819510-155819532 TCTGCCTGCCAGAGAAAGCTGGG - Intergenic
1036594659 8:10200854-10200876 GGTGGCTGTCACTCAAATCTGGG - Intronic
1038846138 8:31231138-31231160 GATACCTGCCTGTCAAAGCTTGG + Intergenic
1039716318 8:40113403-40113425 GTTGCCTGCCAGGAAAATTTAGG - Intergenic
1042931298 8:74016273-74016295 GCTGCCTTGCAGTTCAATCTTGG - Intronic
1043089185 8:75876065-75876087 GCTGCCTCGCAGTTCAATCTTGG + Intergenic
1045401620 8:101824824-101824846 TTTGCCTGCCAGCCAAATGTGGG - Intronic
1046049261 8:109001893-109001915 GCTCCCTGACTGTCAAGTCTTGG - Intergenic
1049205685 8:141362440-141362462 GCTCTCTGCCAGGCCAATCTGGG - Intronic
1049246425 8:141565226-141565248 GCTGCCTGCCAGGCAAGGCCTGG - Intergenic
1049484839 8:142850336-142850358 GCTGCCTTGCAGTTCAATCTTGG - Intronic
1050483048 9:6105598-6105620 ACTGCTTGCCTGTCAATTCTGGG - Intergenic
1054800955 9:69347580-69347602 GCTGTGTCCCAGTCAAAACTTGG - Intronic
1057114485 9:92507631-92507653 GCTGCCTGCCAGGAACATCGAGG - Intronic
1057752572 9:97804126-97804148 ACAGACTGCCAGTCAAAACTAGG + Intergenic
1058326711 9:103707429-103707451 ACTTCCTGCCAGTAGAATCTTGG + Intergenic
1059662301 9:116414176-116414198 ACTGCCTGTCTGTCAAAGCTGGG - Intergenic
1060283094 9:122227084-122227106 GCTGCCTTGGAGACAAATCTGGG + Intronic
1187374514 X:18739860-18739882 GCTGCCTTGCAGTTCAATCTTGG + Intronic
1187672367 X:21680825-21680847 GCTTCCTGCTGGTCAAATTTAGG + Intergenic
1190725423 X:53187290-53187312 GCTTCCTGCCAGTAGAATTTTGG - Intergenic
1193343772 X:80382726-80382748 GCTGCCTCGCAGTTCAATCTGGG + Intronic
1194355173 X:92874250-92874272 GCTTCCTGCCAGTAGAATTTTGG + Intergenic
1195992356 X:110695311-110695333 GATGCCTGACACTAAAATCTAGG - Intronic
1197674590 X:129315592-129315614 TCTGCCAGCCAGTCAGATCAAGG + Intergenic
1197720121 X:129739273-129739295 GCTGCCTTCCAGTGGAAGCTAGG - Intronic
1199212054 X:145224048-145224070 GCTGTCTGCCAGGTAAATCAAGG - Intergenic
1199303995 X:146245536-146245558 GCTGTCTGGGAGTCAAAGCTTGG - Intergenic
1200663531 Y:5991272-5991294 GCTTCCTGCCAGTAGAATTTTGG + Intergenic
1200980228 Y:9257160-9257182 GCTGCCAACCAGTCCAGTCTGGG + Intergenic