ID: 932245176

View in Genome Browser
Species Human (GRCh38)
Location 2:70190765-70190787
Sequence ACCGGAAGTGAGCGCTCGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 23
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 22}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932245176_932245186 27 Left 932245176 2:70190765-70190787 CCGCGCGAGCGCTCACTTCCGGT 0: 1
1: 0
2: 0
3: 0
4: 22
Right 932245186 2:70190815-70190837 CCTCGCCGGCAGCCGCTCCTTGG 0: 1
1: 0
2: 2
3: 21
4: 124
932245176_932245184 13 Left 932245176 2:70190765-70190787 CCGCGCGAGCGCTCACTTCCGGT 0: 1
1: 0
2: 0
3: 0
4: 22
Right 932245184 2:70190801-70190823 AGGCAGAAGCATCACCTCGCCGG 0: 1
1: 0
2: 2
3: 14
4: 190
932245176_932245178 -7 Left 932245176 2:70190765-70190787 CCGCGCGAGCGCTCACTTCCGGT 0: 1
1: 0
2: 0
3: 0
4: 22
Right 932245178 2:70190781-70190803 TTCCGGTCCCAAGTAGGCCCAGG 0: 1
1: 0
2: 0
3: 14
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932245176 Original CRISPR ACCGGAAGTGAGCGCTCGCG CGG (reversed) Intronic