ID: 932245178

View in Genome Browser
Species Human (GRCh38)
Location 2:70190781-70190803
Sequence TTCCGGTCCCAAGTAGGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 128}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932245168_932245178 20 Left 932245168 2:70190738-70190760 CCTGGGACCTGCTTCCCGGCATC 0: 1
1: 0
2: 1
3: 25
4: 213
Right 932245178 2:70190781-70190803 TTCCGGTCCCAAGTAGGCCCAGG 0: 1
1: 0
2: 0
3: 14
4: 128
932245167_932245178 21 Left 932245167 2:70190737-70190759 CCCTGGGACCTGCTTCCCGGCAT 0: 1
1: 0
2: 1
3: 23
4: 274
Right 932245178 2:70190781-70190803 TTCCGGTCCCAAGTAGGCCCAGG 0: 1
1: 0
2: 0
3: 14
4: 128
932245169_932245178 13 Left 932245169 2:70190745-70190767 CCTGCTTCCCGGCATCCTCCCCG 0: 1
1: 0
2: 1
3: 29
4: 535
Right 932245178 2:70190781-70190803 TTCCGGTCCCAAGTAGGCCCAGG 0: 1
1: 0
2: 0
3: 14
4: 128
932245174_932245178 -6 Left 932245174 2:70190764-70190786 CCCGCGCGAGCGCTCACTTCCGG 0: 1
1: 0
2: 0
3: 5
4: 37
Right 932245178 2:70190781-70190803 TTCCGGTCCCAAGTAGGCCCAGG 0: 1
1: 0
2: 0
3: 14
4: 128
932245173_932245178 -5 Left 932245173 2:70190763-70190785 CCCCGCGCGAGCGCTCACTTCCG 0: 1
1: 0
2: 0
3: 3
4: 36
Right 932245178 2:70190781-70190803 TTCCGGTCCCAAGTAGGCCCAGG 0: 1
1: 0
2: 0
3: 14
4: 128
932245166_932245178 22 Left 932245166 2:70190736-70190758 CCCCTGGGACCTGCTTCCCGGCA 0: 1
1: 0
2: 0
3: 13
4: 191
Right 932245178 2:70190781-70190803 TTCCGGTCCCAAGTAGGCCCAGG 0: 1
1: 0
2: 0
3: 14
4: 128
932245170_932245178 6 Left 932245170 2:70190752-70190774 CCCGGCATCCTCCCCGCGCGAGC 0: 1
1: 0
2: 2
3: 8
4: 89
Right 932245178 2:70190781-70190803 TTCCGGTCCCAAGTAGGCCCAGG 0: 1
1: 0
2: 0
3: 14
4: 128
932245176_932245178 -7 Left 932245176 2:70190765-70190787 CCGCGCGAGCGCTCACTTCCGGT 0: 1
1: 0
2: 0
3: 0
4: 22
Right 932245178 2:70190781-70190803 TTCCGGTCCCAAGTAGGCCCAGG 0: 1
1: 0
2: 0
3: 14
4: 128
932245171_932245178 5 Left 932245171 2:70190753-70190775 CCGGCATCCTCCCCGCGCGAGCG 0: 1
1: 0
2: 0
3: 9
4: 79
Right 932245178 2:70190781-70190803 TTCCGGTCCCAAGTAGGCCCAGG 0: 1
1: 0
2: 0
3: 14
4: 128
932245172_932245178 -2 Left 932245172 2:70190760-70190782 CCTCCCCGCGCGAGCGCTCACTT 0: 1
1: 0
2: 0
3: 4
4: 46
Right 932245178 2:70190781-70190803 TTCCGGTCCCAAGTAGGCCCAGG 0: 1
1: 0
2: 0
3: 14
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932245178 Original CRISPR TTCCGGTCCCAAGTAGGCCC AGG Intronic