ID: 932245184

View in Genome Browser
Species Human (GRCh38)
Location 2:70190801-70190823
Sequence AGGCAGAAGCATCACCTCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 190}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932245176_932245184 13 Left 932245176 2:70190765-70190787 CCGCGCGAGCGCTCACTTCCGGT 0: 1
1: 0
2: 0
3: 0
4: 22
Right 932245184 2:70190801-70190823 AGGCAGAAGCATCACCTCGCCGG 0: 1
1: 0
2: 2
3: 14
4: 190
932245180_932245184 -10 Left 932245180 2:70190788-70190810 CCCAAGTAGGCCCAGGCAGAAGC 0: 1
1: 0
2: 1
3: 5
4: 191
Right 932245184 2:70190801-70190823 AGGCAGAAGCATCACCTCGCCGG 0: 1
1: 0
2: 2
3: 14
4: 190
932245172_932245184 18 Left 932245172 2:70190760-70190782 CCTCCCCGCGCGAGCGCTCACTT 0: 1
1: 0
2: 0
3: 4
4: 46
Right 932245184 2:70190801-70190823 AGGCAGAAGCATCACCTCGCCGG 0: 1
1: 0
2: 2
3: 14
4: 190
932245171_932245184 25 Left 932245171 2:70190753-70190775 CCGGCATCCTCCCCGCGCGAGCG 0: 1
1: 0
2: 0
3: 9
4: 79
Right 932245184 2:70190801-70190823 AGGCAGAAGCATCACCTCGCCGG 0: 1
1: 0
2: 2
3: 14
4: 190
932245179_932245184 -5 Left 932245179 2:70190783-70190805 CCGGTCCCAAGTAGGCCCAGGCA 0: 1
1: 0
2: 0
3: 16
4: 147
Right 932245184 2:70190801-70190823 AGGCAGAAGCATCACCTCGCCGG 0: 1
1: 0
2: 2
3: 14
4: 190
932245170_932245184 26 Left 932245170 2:70190752-70190774 CCCGGCATCCTCCCCGCGCGAGC 0: 1
1: 0
2: 2
3: 8
4: 89
Right 932245184 2:70190801-70190823 AGGCAGAAGCATCACCTCGCCGG 0: 1
1: 0
2: 2
3: 14
4: 190
932245173_932245184 15 Left 932245173 2:70190763-70190785 CCCCGCGCGAGCGCTCACTTCCG 0: 1
1: 0
2: 0
3: 3
4: 36
Right 932245184 2:70190801-70190823 AGGCAGAAGCATCACCTCGCCGG 0: 1
1: 0
2: 2
3: 14
4: 190
932245174_932245184 14 Left 932245174 2:70190764-70190786 CCCGCGCGAGCGCTCACTTCCGG 0: 1
1: 0
2: 0
3: 5
4: 37
Right 932245184 2:70190801-70190823 AGGCAGAAGCATCACCTCGCCGG 0: 1
1: 0
2: 2
3: 14
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932245184 Original CRISPR AGGCAGAAGCATCACCTCGC CGG Intronic