ID: 932245186

View in Genome Browser
Species Human (GRCh38)
Location 2:70190815-70190837
Sequence CCTCGCCGGCAGCCGCTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 124}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932245183_932245186 -7 Left 932245183 2:70190799-70190821 CCAGGCAGAAGCATCACCTCGCC 0: 1
1: 0
2: 1
3: 28
4: 190
Right 932245186 2:70190815-70190837 CCTCGCCGGCAGCCGCTCCTTGG 0: 1
1: 0
2: 2
3: 21
4: 124
932245179_932245186 9 Left 932245179 2:70190783-70190805 CCGGTCCCAAGTAGGCCCAGGCA 0: 1
1: 0
2: 0
3: 16
4: 147
Right 932245186 2:70190815-70190837 CCTCGCCGGCAGCCGCTCCTTGG 0: 1
1: 0
2: 2
3: 21
4: 124
932245181_932245186 3 Left 932245181 2:70190789-70190811 CCAAGTAGGCCCAGGCAGAAGCA 0: 1
1: 0
2: 1
3: 27
4: 474
Right 932245186 2:70190815-70190837 CCTCGCCGGCAGCCGCTCCTTGG 0: 1
1: 0
2: 2
3: 21
4: 124
932245174_932245186 28 Left 932245174 2:70190764-70190786 CCCGCGCGAGCGCTCACTTCCGG 0: 1
1: 0
2: 0
3: 5
4: 37
Right 932245186 2:70190815-70190837 CCTCGCCGGCAGCCGCTCCTTGG 0: 1
1: 0
2: 2
3: 21
4: 124
932245182_932245186 -6 Left 932245182 2:70190798-70190820 CCCAGGCAGAAGCATCACCTCGC 0: 1
1: 0
2: 1
3: 23
4: 413
Right 932245186 2:70190815-70190837 CCTCGCCGGCAGCCGCTCCTTGG 0: 1
1: 0
2: 2
3: 21
4: 124
932245176_932245186 27 Left 932245176 2:70190765-70190787 CCGCGCGAGCGCTCACTTCCGGT 0: 1
1: 0
2: 0
3: 0
4: 22
Right 932245186 2:70190815-70190837 CCTCGCCGGCAGCCGCTCCTTGG 0: 1
1: 0
2: 2
3: 21
4: 124
932245180_932245186 4 Left 932245180 2:70190788-70190810 CCCAAGTAGGCCCAGGCAGAAGC 0: 1
1: 0
2: 1
3: 5
4: 191
Right 932245186 2:70190815-70190837 CCTCGCCGGCAGCCGCTCCTTGG 0: 1
1: 0
2: 2
3: 21
4: 124
932245173_932245186 29 Left 932245173 2:70190763-70190785 CCCCGCGCGAGCGCTCACTTCCG 0: 1
1: 0
2: 0
3: 3
4: 36
Right 932245186 2:70190815-70190837 CCTCGCCGGCAGCCGCTCCTTGG 0: 1
1: 0
2: 2
3: 21
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932245186 Original CRISPR CCTCGCCGGCAGCCGCTCCT TGG Intronic