ID: 932245250

View in Genome Browser
Species Human (GRCh38)
Location 2:70191081-70191103
Sequence CCTGAGCTCGCGTTGTCTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 32
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 30}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932245243_932245250 5 Left 932245243 2:70191053-70191075 CCGCCCACGCGCGGCAAGTGGCC 0: 1
1: 0
2: 0
3: 3
4: 37
Right 932245250 2:70191081-70191103 CCTGAGCTCGCGTTGTCTTATGG 0: 1
1: 0
2: 0
3: 1
4: 30
932245244_932245250 2 Left 932245244 2:70191056-70191078 CCCACGCGCGGCAAGTGGCCGCC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 932245250 2:70191081-70191103 CCTGAGCTCGCGTTGTCTTATGG 0: 1
1: 0
2: 0
3: 1
4: 30
932245245_932245250 1 Left 932245245 2:70191057-70191079 CCACGCGCGGCAAGTGGCCGCCC 0: 1
1: 0
2: 0
3: 2
4: 64
Right 932245250 2:70191081-70191103 CCTGAGCTCGCGTTGTCTTATGG 0: 1
1: 0
2: 0
3: 1
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932245250 Original CRISPR CCTGAGCTCGCGTTGTCTTA TGG Intronic
902902451 1:19528670-19528692 CCTGTGCTTGCGGTGTCTGATGG - Intergenic
911557225 1:99359830-99359852 CCTGAGCTGCAGTTGTCTTATGG - Intergenic
919631744 1:199966309-199966331 CCTGAGTCCCTGTTGTCTTAAGG + Intergenic
922478832 1:225924545-225924567 CCTGAGCCCGAGGTGGCTTAGGG - Intergenic
923755444 1:236786829-236786851 CCTGAGCTCTGGTAGTGTTATGG - Intergenic
1064604331 10:17022946-17022968 CCTAAGCTCGATGTGTCTTACGG + Intronic
1073542247 10:104323792-104323814 CCTGAGCTGGCCTTGTGCTATGG - Intronic
1079700905 11:23545723-23545745 CCTTAGCTCCAGTTGTCATAGGG + Intergenic
1084543325 11:69800772-69800794 ACTGCGCTCGGCTTGTCTTAGGG - Intergenic
1086457618 11:86974935-86974957 CCTGTTCTCTCGTTGTGTTAGGG - Intergenic
1090131255 11:124144963-124144985 CTAGAGCTGGCCTTGTCTTAGGG + Intronic
1122517489 14:102319164-102319186 CCTGAGCGTGCGTTGTGTTCTGG + Intronic
1124926705 15:34077015-34077037 CCTGAACTCGCCTTATCTTCTGG - Intergenic
1132881883 16:2165943-2165965 CCTGGGCTGGCCTTGGCTTAAGG - Intronic
929803367 2:45123342-45123364 CATGTGCTAGCTTTGTCTTAAGG + Intergenic
930383206 2:50658241-50658263 CCTCAGCTAGCGTTGTTTTGAGG - Intronic
932245250 2:70191081-70191103 CCTGAGCTCGCGTTGTCTTATGG + Intronic
1172639193 20:36431010-36431032 CCTGAACTCTCCTTGCCTTATGG - Intronic
1175430389 20:58897936-58897958 CCTGATCTTGCGTTTTGTTAGGG + Intronic
962257161 3:133880455-133880477 CCTGAGCAAGCTTTGTCTCATGG - Intronic
970322954 4:14893641-14893663 TCTGAGCTTGAGTTGTGTTAGGG + Intergenic
971573159 4:28239446-28239468 TCTGAGCTCAAGTTGCCTTAAGG - Intergenic
971576402 4:28280500-28280522 TCTGAGCTCAGGCTGTCTTAGGG - Intergenic
984288880 4:177767252-177767274 CCTGAGCTCCTGATGTCTAAGGG + Intronic
1017036037 6:150268211-150268233 CCTGAGCACGAGTTGTCCTGAGG + Intergenic
1019139227 6:169933248-169933270 CCTGAGCTCTCCTTGTCCTCTGG + Intergenic
1028403991 7:90456595-90456617 ACTGAGTTTGAGTTGTCTTAAGG + Intronic
1037693816 8:21206715-21206737 CCTGAGCTCGCCATGATTTAAGG + Intergenic
1047286084 8:123488373-123488395 CCTGAGATTTCGTTGTCTCATGG - Intergenic
1051078704 9:13271726-13271748 CCTGCACTTCCGTTGTCTTATGG - Intronic
1058153318 9:101486099-101486121 ACTGCGCTCGCGGTGTCTTGGGG - Intronic
1188719013 X:33500138-33500160 CCTGAGCTCAGGCTGTCTTTGGG - Intergenic