ID: 932246316

View in Genome Browser
Species Human (GRCh38)
Location 2:70199663-70199685
Sequence GCTGCAGGTGGGACACATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 299}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932246316_932246322 -3 Left 932246316 2:70199663-70199685 CCCTCATGTGTCCCACCTGCAGC 0: 1
1: 0
2: 2
3: 21
4: 299
Right 932246322 2:70199683-70199705 AGCTGCCTCCAAGGCAGCTTTGG 0: 1
1: 0
2: 2
3: 23
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932246316 Original CRISPR GCTGCAGGTGGGACACATGA GGG (reversed) Intronic
900373136 1:2341138-2341160 GCAACAGGTGGGACACAGCAGGG - Intronic
901288696 1:8104615-8104637 GCTGAAGCTGGGACTCATGTGGG - Intergenic
901574857 1:10192605-10192627 GCTGGAGGAGAGACACAGGAAGG - Intergenic
902802712 1:18840267-18840289 GCTGCTGGTGGCATACATGGTGG - Exonic
904029651 1:27526175-27526197 GGTGCAGGTGGGACATGTCAGGG + Intergenic
904399666 1:30247898-30247920 TCTGCAGGTGGGACCCAGGTAGG - Intergenic
908469374 1:64428003-64428025 GCTGAAGGAGAAACACATGAAGG + Intergenic
908826535 1:68138032-68138054 TCTACATGTGGGAAACATGAAGG + Intronic
909913703 1:81292133-81292155 GTTGCAGATGGGCCAAATGAAGG + Intergenic
911515073 1:98858093-98858115 ACTGAAGATGGGAAACATGAAGG - Intergenic
912331984 1:108828341-108828363 GCTGCAGGTGGGCCACAGGAAGG - Intronic
915225763 1:154410195-154410217 TCTGCAGGTGGGATCCTTGAGGG + Intronic
916638499 1:166700267-166700289 GTTGCAGGTCCAACACATGAGGG + Intergenic
918347917 1:183622742-183622764 GCTGCACGTGGTACTCATGGTGG + Intergenic
919779452 1:201212871-201212893 GCTTTTGGTGGGACCCATGAAGG + Exonic
920376957 1:205513924-205513946 GCTGCTGTTGGGCCACATGCTGG + Intronic
920690154 1:208140134-208140156 GCAGAAGGTGGGACAGAGGAGGG + Intronic
921482027 1:215674674-215674696 GCTGCAGGTGGGAAACCAGCAGG + Exonic
921988662 1:221340257-221340279 GTTGCAGGTTGCACACAAGAAGG + Intergenic
1063123984 10:3124177-3124199 GCTACTGGTGGGACACAGGGCGG - Intronic
1063161325 10:3420919-3420941 GATGCAGGTGGGACGCAGGTAGG + Intergenic
1063161344 10:3421007-3421029 GGTGCGGGTGGGACACAGCAGGG + Intergenic
1068491018 10:57723646-57723668 GCTGTATGTGGGGTACATGAAGG - Intergenic
1069298128 10:66872712-66872734 GATTCAGGTGGTACACGTGAAGG + Intronic
1069942776 10:71966237-71966259 GCTGGAGATGGGTCTCATGAAGG + Intronic
1070481601 10:76888275-76888297 TCTGCAGGTGAGTCTCATGATGG + Intronic
1070657834 10:78283377-78283399 GCTGCAGGTGGGAGGCCTGCAGG + Intergenic
1071489716 10:86128086-86128108 GCTGCTGGTGGCACAGAGGAAGG - Intronic
1071503704 10:86220690-86220712 GCAGCATGTGGGACACAGGCTGG - Intronic
1071841219 10:89473743-89473765 GCTTCAAATGGGACACATTAAGG - Intronic
1072296021 10:94010125-94010147 GATGCAAGTGTGACACAGGATGG - Intronic
1073266143 10:102229661-102229683 TCTGCAGGTGGGACGCCTGAGGG + Intergenic
1073442438 10:103560334-103560356 TCTTGAGGTGGGACACAAGAGGG + Intronic
1074693566 10:116028319-116028341 GCTGAAGCTGGTACCCATGAAGG - Intergenic
1076250203 10:128979113-128979135 GACGAAGGTGGGACACATGGAGG + Intergenic
1076467922 10:130697745-130697767 GCAGAAGGTGGGCCAGATGATGG + Intergenic
1077560493 11:3257424-3257446 GATGCAGGTGGGACTCAGGCAGG - Intergenic
1077560550 11:3257677-3257699 GATGCAGGTGGGACTCAGGTAGG - Intergenic
1077560570 11:3257776-3257798 GATGCAGGTGGGACTCAGGTGGG - Intergenic
1077560579 11:3257820-3257842 GATGCAGGTGGGACTCAGGTGGG - Intergenic
1077566389 11:3303241-3303263 GATGCAGGTGGGACTCAGGCAGG - Intergenic
1077566449 11:3303516-3303538 GATGCAGGTGGGACTCAGGTAGG - Intergenic
1077702928 11:4458322-4458344 GCTACAGATTGGACACATGCAGG - Intergenic
1079083052 11:17427456-17427478 GTTGGAGGTGGGACCCAGGATGG - Intronic
1080888780 11:36390324-36390346 GGTGCTGGTGGAAGACATGAAGG + Intronic
1082809627 11:57471589-57471611 GGTGCAGGTGTGACCCAAGATGG + Intronic
1083002702 11:59310164-59310186 GCAGAGGGTGGGAAACATGATGG + Intergenic
1083047434 11:59749414-59749436 GCTAGAGCTGGGACACAAGAAGG - Intronic
1083536227 11:63468985-63469007 GCTTCAGGTGGGTCACGTGGGGG - Intronic
1083707611 11:64526893-64526915 GCAGCAGGTGTGACCCATGGTGG - Intergenic
1088652652 11:111972093-111972115 GAAGCAGGTGGTACACATGCAGG - Intronic
1089742259 11:120592756-120592778 GTTGCAGGAGGGGCACATGTGGG - Intronic
1091232779 11:133999376-133999398 GTTGGAGGTGGGACCCAGGAAGG - Intergenic
1091250755 11:134141829-134141851 GCTGCAGGAGGTACACATGCAGG + Intronic
1093855925 12:24102155-24102177 GCAGCAGGTGCTACACAGGAAGG - Intergenic
1093915025 12:24792083-24792105 ACTGCAGGTGGCAGATATGATGG - Intergenic
1094061938 12:26323570-26323592 TCTGCAGGTGAGACACATTCTGG - Intergenic
1095950438 12:47779006-47779028 CCTGCAGGAGAGACACATCAGGG - Exonic
1096065824 12:48739368-48739390 GCTGCAGCTAGGACAGAAGAAGG + Intergenic
1097307332 12:58083977-58083999 GATGCAGGTTGGCCACATGAGGG + Intergenic
1102137029 12:110583580-110583602 ATTGCAGGTGGGCCACGTGAGGG + Intergenic
1102257050 12:111421990-111422012 ACTGCCGGTGGGACACAAAATGG - Intronic
1103075603 12:117979990-117980012 GCTAAAGCTGGGACAGATGAAGG + Intergenic
1103465444 12:121138783-121138805 GCTCCTGGTGGGACTCAGGAAGG - Intronic
1104290052 12:127458191-127458213 GATTCAGGAGGGACACATGCAGG + Intergenic
1104914265 12:132256667-132256689 GCTGGAGGGGGGACACTGGAAGG + Intronic
1105209165 13:18247735-18247757 GCTGCAGGGAGGACACATACAGG - Intergenic
1105455847 13:20540471-20540493 GCTGCAGTTGGGCCAGATGATGG + Intergenic
1106671442 13:31910070-31910092 GCTGCACGTGGGACACCAGAGGG + Intergenic
1107668643 13:42719223-42719245 GGTGCCTGTGGGACACATGCAGG + Intergenic
1112454689 13:99548240-99548262 TCTGCAGCTGGGAGACCTGAAGG - Intronic
1113893779 13:113750045-113750067 GCTGATGGTGGGACACCTGCTGG + Intergenic
1114482314 14:23043495-23043517 GCTGAAGCTGAGACACATAAAGG - Exonic
1119674557 14:76544195-76544217 GCTGGAGATGGGGCACATGCAGG - Intergenic
1120576239 14:86184729-86184751 GGTGCAGATGGCACAAATGATGG + Intergenic
1121288803 14:92757807-92757829 TCGAGAGGTGGGACACATGATGG - Intergenic
1121636962 14:95460643-95460665 GCTGCAGGCGGGAAGCATGAAGG - Intronic
1122157088 14:99756196-99756218 ACTGCAGGTGGCACATCTGATGG + Intronic
1122472876 14:101983906-101983928 GAGGCAGGTGGAACACTTGAAGG - Intronic
1122596660 14:102898495-102898517 GGTGCAGGCGGGCCACAGGATGG - Intronic
1122744201 14:103888416-103888438 GGTGCAGGTGAGTCACCTGAGGG + Intergenic
1122825694 14:104369414-104369436 GTTGCAGTGGGGACACAGGATGG + Intergenic
1123003121 14:105307235-105307257 GAGGCAGGTGGGACTCATGATGG - Exonic
1123113123 14:105882202-105882224 GGTGTAGGTGGGACTCAGGATGG + Intergenic
1124048127 15:26169886-26169908 TCCACAGGTGGGACACATGATGG - Intergenic
1124362303 15:29046607-29046629 GCTGCAGGTGGTTCTCATGTTGG - Intronic
1126374026 15:47976319-47976341 GCTTCAGGTGGGACCTATGAGGG + Intergenic
1126739612 15:51764454-51764476 GCTGCAGGTGGGCCTCTTAAGGG - Intronic
1126780402 15:52134720-52134742 TCTGCAGCTGGGACACATAAGGG - Intronic
1128955534 15:71939225-71939247 GGTTCAGGGGGTACACATGAAGG + Intronic
1131551605 15:93362186-93362208 TCACCAGGTGGGACACATAAAGG - Intergenic
1131721430 15:95172684-95172706 ACTGAAGCTGGGACACAAGATGG - Intergenic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1133370939 16:5245150-5245172 GATGCAGGCGAGTCACATGATGG + Intergenic
1137035642 16:35567421-35567443 CCTGCAGCTGGGACATGTGAAGG - Intergenic
1137632700 16:49958114-49958136 GCTGAAGGAGGGACCCAGGAAGG + Intergenic
1138545865 16:57719103-57719125 GCAGCATGTGGGGCTCATGATGG - Intronic
1139291310 16:65860477-65860499 GCTGCAGGTGGCATCCAGGAGGG - Intergenic
1139958531 16:70704796-70704818 GCTGCAGGTGAGGCCCAGGAGGG + Intronic
1140950898 16:79816389-79816411 GCTGAAGGTGGGACACAGCCTGG - Intergenic
1141483026 16:84319409-84319431 GCTGCAGGAGGGACACACGCTGG - Exonic
1141976907 16:87522811-87522833 GCAGCAGGTGGATCACCTGAGGG - Intergenic
1142968286 17:3594614-3594636 GCTGCAGGGGGTCCACCTGATGG - Intronic
1143614171 17:8039628-8039650 GCTGCAGGGGGAGCACAGGAAGG + Intronic
1144622866 17:16829666-16829688 GTGGGAGGTGGGACACAGGATGG - Intergenic
1144668541 17:17118388-17118410 GTTTCATGTGGGACACCTGAAGG + Intronic
1144819943 17:18065550-18065572 GCTGGAGGTGGGACGGAGGAAGG - Exonic
1144883565 17:18443050-18443072 GTGGGAGGTGGGACACAGGATGG + Intergenic
1145148663 17:20501336-20501358 GTGGGAGGTGGGACACAGGATGG - Intergenic
1145713554 17:26997428-26997450 TCTCCACCTGGGACACATGATGG - Intergenic
1146372046 17:32270711-32270733 GCAGCAGGTGGGAGACCTGAGGG + Intronic
1146656964 17:34640108-34640130 GCTGCTTCTGGGACACATGCTGG - Intergenic
1147577188 17:41609601-41609623 GTGGGAGGTGGGACACAGGATGG - Intergenic
1148117173 17:45182959-45182981 CCTGCTGGTGGCACACATGGGGG + Intergenic
1148245506 17:46027378-46027400 TCTGCAGGTGGGAGAAGTGAGGG - Exonic
1148831818 17:50437948-50437970 GCTGCAGGAGGGACAGAAAAGGG - Intronic
1149479626 17:56992274-56992296 CCTGCAGATGGCAAACATGAGGG - Intronic
1150335249 17:64326243-64326265 GCTGCAGGTGGAACTCAGCAAGG + Intronic
1151358264 17:73573008-73573030 AGTGCAGGTGTGCCACATGAAGG + Intronic
1151395558 17:73820298-73820320 GCTGCAGGGAGGACACAGGGAGG - Intergenic
1152576759 17:81144496-81144518 GCTGCAGCTGGGACAATGGAGGG + Intronic
1154321782 18:13360040-13360062 GCTGTAGGTGGGCCACAGAATGG + Intronic
1155655477 18:28187131-28187153 GCTGGAGCTTGGACACATGAAGG + Intergenic
1156500041 18:37551735-37551757 GCTGCAATTGGGACAGCTGAAGG + Intronic
1156510186 18:37629860-37629882 GCTGCAGATGGAGCACATTAAGG - Intergenic
1158009531 18:52712897-52712919 GCTTCAGGTGAGACACAAGGAGG - Intronic
1159953591 18:74503864-74503886 ACTGCCGCTGGGACAAATGAGGG + Intronic
1159953601 18:74503918-74503940 ACTGCCGCTGGGACAAATGAGGG + Intronic
1159953610 18:74503972-74503994 ACTGCCGCTGGGACAAATGAGGG + Intronic
1159953618 18:74504026-74504048 ACTGCTGCTGGGACAAATGATGG + Intronic
1159953636 18:74504134-74504156 ACTGCCGCTGGGACAAATGAGGG + Intronic
1159953672 18:74504350-74504372 ACTGCCGCTGGGACAAATGAGGG + Intronic
1161792443 19:6368504-6368526 GCAGGAGGTGAGACACATTAGGG - Intronic
1162066075 19:8126210-8126232 GCCGGAGGTGGCACCCATGAGGG + Intronic
1162277115 19:9664706-9664728 GATGCAGGTGGATCACCTGAGGG + Intronic
1165160004 19:33810446-33810468 GAGGCAGGTGGATCACATGAGGG + Intronic
1165713434 19:38028298-38028320 GTGGCAGGGGGGACAGATGAAGG - Intronic
1165829122 19:38721878-38721900 GCCCCAGGTGGGACACCTGAAGG + Intronic
1166352794 19:42208080-42208102 GCTGCAGGGAAGACAGATGAGGG - Intronic
1166812444 19:45522429-45522451 GCTGCAGCTGGGACCCCCGAAGG - Exonic
1166913467 19:46177724-46177746 GCTGCAGCTGGGGGAGATGAGGG + Intergenic
925740959 2:7005822-7005844 GCTGCAGCTCAGAGACATGAAGG + Intronic
925884095 2:8379716-8379738 GCTGCAGGTGTGATTTATGAGGG - Intergenic
928138298 2:28705580-28705602 GCTGGAGTTGAGACACAAGAAGG - Intergenic
928705890 2:33949449-33949471 GCTGAAGATGGAACACATGTGGG - Intergenic
929248776 2:39730436-39730458 CCTGCACGTGGGAAACTTGACGG - Intergenic
930176391 2:48305419-48305441 GAGGCAGGTGGGTCACTTGAGGG - Intergenic
931426675 2:62178060-62178082 GTAGCAGCTGGGTCACATGAAGG - Intergenic
932246316 2:70199663-70199685 GCTGCAGGTGGGACACATGAGGG - Intronic
932574401 2:72954788-72954810 GCTGCAGGCCGGGCACCTGAGGG + Intronic
932734234 2:74243158-74243180 ACTGCATGTGGATCACATGACGG + Intronic
933314241 2:80697048-80697070 ACTTCAGGTGAGACAGATGAAGG + Intergenic
933671038 2:85007507-85007529 GCTGGAGGTGGGCCAAGTGAAGG - Intronic
933703535 2:85273284-85273306 ACTGCAGGTGAAACACAGGAGGG - Intronic
934116946 2:88807623-88807645 GATGCACCTGGGACAGATGAGGG - Intergenic
934976966 2:98809460-98809482 CCTGCAGTTGGGAGACATGAAGG - Intronic
936110319 2:109659544-109659566 GCTGTGGGTGGGACAGATGGTGG + Intergenic
936160442 2:110080564-110080586 GATGCACCTGGGACAAATGAGGG - Intergenic
936184222 2:110290790-110290812 GATGCACCTGGGACAAATGAGGG + Intergenic
937393103 2:121509604-121509626 GAGGCAGGTGGAACACACGAGGG + Intronic
937656526 2:124383068-124383090 GCTGGAGCTGGGACACCTGGAGG - Intronic
938711311 2:133978252-133978274 GCTGTTGGTGGGACACAAGGAGG + Intergenic
943996513 2:194773154-194773176 GCTGTAGGTTTTACACATGAGGG - Intergenic
947007699 2:225530946-225530968 TGTCCAGGTGGGAAACATGATGG - Intronic
948507098 2:238435689-238435711 GCTGCAGGAGGAACACAAGGGGG - Exonic
948599310 2:239099447-239099469 GCTGCCTGTGGGCCCCATGAGGG - Intronic
1170005077 20:11659010-11659032 GCTCCAGGTGGGAAGCACGATGG + Intergenic
1170272788 20:14547230-14547252 CATGCAGGAGGGACACGTGAAGG + Intronic
1170812842 20:19687982-19688004 GCTTCAGGAAGGACACAGGAGGG - Intronic
1171290338 20:23979448-23979470 GCTGCAGGGAGGACACATACAGG - Intergenic
1175465964 20:59191531-59191553 GCCGCAGGTGGCACACGGGAAGG - Exonic
1175541984 20:59753762-59753784 GCAGGTGGTGGGACGCATGATGG + Intronic
1176061011 20:63172997-63173019 GCTCCATGGGGGACACCTGAGGG + Intergenic
1176264186 20:64200127-64200149 GATGCTGGTGCGCCACATGATGG - Intronic
1177938072 21:27374623-27374645 GCTGCATGTGGGACATATTTGGG + Intergenic
1178169966 21:30029423-30029445 CCTGAAGGTGAGACACATTACGG + Intergenic
1179112618 21:38460525-38460547 GTTGCATGTGGGACAAAGGATGG - Intronic
1180082513 21:45493325-45493347 GCTGCTGCTGTGACACGTGAGGG + Intronic
1180119468 21:45737139-45737161 GGTGCAGCTGGGGCACATCAGGG + Intronic
1181396877 22:22629224-22629246 TCTGCAGGTGGAACCCAGGAAGG + Intergenic
1181401650 22:22653423-22653445 GCTGCAGGGAGGACACATACAGG + Intergenic
1181556484 22:23674522-23674544 GCTGCAGGTGGGACAATGGCTGG + Intergenic
1181703608 22:24634520-24634542 GCTGCAGGGAGGACACATACAGG + Intergenic
1182868372 22:33624811-33624833 GAAGCAGGAAGGACACATGAAGG + Intronic
1182872072 22:33656546-33656568 GCTGCAGGCAGGGCACATAAAGG + Intronic
1183290249 22:36997587-36997609 ACTCCAGATGGGACAGATGATGG - Intronic
1183949308 22:41343783-41343805 GAGGCAGGTGGGACACATTTGGG + Intronic
1184798588 22:46746670-46746692 GCTTCAGGTGGAGCCCATGAAGG + Intergenic
1185054898 22:48574584-48574606 GGTGCATGTGGTTCACATGAAGG - Intronic
950590162 3:13931341-13931363 GATGGAGGTGGGACAAGTGATGG - Intergenic
950710246 3:14809002-14809024 GATGGAGGTGGGACAGGTGAGGG - Intergenic
953347009 3:42184774-42184796 GGAGCAGGTGGAACACATCAGGG + Exonic
957181579 3:76885875-76885897 GATGCAACTGGGACACATCAGGG + Intronic
957734674 3:84190036-84190058 GCTGCTGCAGGGAGACATGATGG + Intergenic
959477630 3:106830566-106830588 GCCCCAGGTGGGACTCAAGAGGG - Intergenic
960402444 3:117218206-117218228 GCGGAAGGTGGGAGAAATGATGG + Intergenic
961386542 3:126526240-126526262 CCTGCAGGTGGCACACAGGGAGG + Intronic
961431680 3:126888532-126888554 GCAGCAGGTGGGGCACAGCAGGG - Intronic
962204601 3:133424520-133424542 GCTGGAGGTGGGAGAGATTAGGG - Intronic
962431975 3:135328280-135328302 GCTGCAGGTGAGAGAGCTGAGGG + Intergenic
963723072 3:148886459-148886481 GGTACAGGTGGGAAACAGGAAGG - Intronic
965964089 3:174466190-174466212 GCTGCATGTGGGCCACAGGTTGG - Intronic
969522342 4:7685809-7685831 GCTGCAGGAGGGACACAGTCAGG - Intronic
969541017 4:7788906-7788928 GCTGCAGCAGGGACAAAGGATGG + Intronic
970149019 4:13069451-13069473 GCTGCCAGTGGGAAACTTGAAGG - Intergenic
970882407 4:20947398-20947420 GAGGCAGGTGGACCACATGAGGG - Intronic
972070453 4:35013244-35013266 GATGCAGGGGGTACACGTGAAGG + Intergenic
972869841 4:43284069-43284091 AGTGCAGGTGGCACTCATGACGG - Intergenic
977396076 4:96472428-96472450 GTTGCAGCTGTGACTCATGATGG - Intergenic
978013581 4:103718252-103718274 GTTGCATGGGGGATACATGAGGG - Intronic
980704485 4:136475157-136475179 CCTGCAGGTGGGGCACTTGGTGG - Intergenic
982636005 4:157897499-157897521 ATTGAAGGTGGGACACATTAAGG + Intergenic
982725962 4:158906623-158906645 ACTACAGGTGGGTCACATGTGGG + Exonic
983501936 4:168509305-168509327 GCTGAAGATGAGACACATGTAGG - Intronic
984003059 4:174274136-174274158 GCTGCAGCTGGGACCAACGATGG - Intronic
986200521 5:5574349-5574371 GCTGCAGGTGGTTCACAGCAGGG - Intergenic
989215482 5:38900452-38900474 CCTGCAGGTGGGACAATCGATGG + Intronic
992645668 5:78808804-78808826 GATGCTGGAGGGACACAGGATGG + Intronic
996374291 5:122787588-122787610 GCTGATGGTTGGACACCTGAAGG + Intronic
997364733 5:133318722-133318744 GCTGCAGCAGGGCCACCTGAAGG + Intronic
997417009 5:133736755-133736777 GCTGCAGGTTGGACACCAGCAGG - Intergenic
997524614 5:134544318-134544340 GATGCAGGTGCTACACAGGAAGG + Intronic
998256424 5:140592008-140592030 GGTGCAGGTGAGACCCTTGAGGG - Intronic
999035649 5:148346179-148346201 GCTACATTTAGGACACATGAGGG - Intergenic
999652681 5:153783022-153783044 GCTGGAGGTGGGAGACCTGCAGG + Intronic
1000631875 5:163599884-163599906 CCTGCAGGAGAGACACAGGAGGG - Intergenic
1002770013 6:282526-282548 GCTGCTGCTGGGACACTTGAGGG + Intergenic
1003270401 6:4602945-4602967 GCTCTAGGTGGGATACAAGAAGG + Intergenic
1004019139 6:11760662-11760684 GCTGTAGCTTGGACACATGTAGG - Intronic
1004832676 6:19494521-19494543 GCTGCATTTGGGAAAAATGAGGG + Intergenic
1007079062 6:39085985-39086007 GCTGCTGGTGGGACACTTGAGGG - Exonic
1008201489 6:48596487-48596509 GATTCAGGGGGTACACATGAAGG + Intergenic
1009651383 6:66481113-66481135 GGTGCAGGTGGGGCACCTGGAGG - Intergenic
1011027196 6:82882004-82882026 GCAGCAGCAGGGACAAATGACGG - Intergenic
1011769352 6:90658851-90658873 GCTGCAGGTGGCTTACAGGATGG + Intergenic
1012310726 6:97721084-97721106 GGTGCAGGTGGGTTAAATGAAGG + Intergenic
1014561964 6:122901616-122901638 AGTGCAGGTGGGCCACAGGAGGG + Intergenic
1014644091 6:123953217-123953239 GCTGCAGATGGGACACAGGTGGG + Intronic
1015950551 6:138548397-138548419 GCTGCATGTGGGCCACAGGTTGG - Intronic
1017257633 6:152351898-152351920 GCTGCAGAACGGACACATGCGGG + Intronic
1017847479 6:158271894-158271916 GCTTCAGGTGAGACAAAGGATGG + Intronic
1018043429 6:159945204-159945226 GCCACAGCTGGGACAGATGAGGG - Intergenic
1019257356 7:60862-60884 TCTCCAGGTGGGGCACATGGAGG + Intergenic
1019265689 7:116377-116399 GGTGCAGGTGGGGCACAGGCTGG - Intergenic
1020117193 7:5482359-5482381 GCCGCAGGTGGGCCACCTCAAGG + Intronic
1020287864 7:6699441-6699463 GCTGCTGATGGGACACACGGTGG + Intronic
1020823164 7:12995842-12995864 ACTCCAGGTGAGAGACATGATGG + Intergenic
1022089050 7:27096045-27096067 GCTGGAGGAGGGGCACGTGACGG + Intergenic
1022339758 7:29456918-29456940 GCTGCAGATGGGGAAGATGAAGG - Intronic
1022972917 7:35533738-35533760 GCTTCAGGAGGTACACATGCAGG + Intergenic
1023026645 7:36056678-36056700 GCTGCAGCTGGGACCTATCAGGG + Intergenic
1024043936 7:45574882-45574904 GCTGCAGCTGGGGCACCTGCAGG - Exonic
1025097528 7:56107937-56107959 GCTGTTGCTGGGACACAGGAAGG - Intergenic
1025986572 7:66458162-66458184 GAGGCAGGTGGATCACATGAGGG + Intergenic
1026038448 7:66846224-66846246 GCTGCAGGTATGATACAAGACGG - Intergenic
1026980064 7:74521160-74521182 GTTCCAGGTGGGACCCAAGAGGG - Intronic
1027212943 7:76165345-76165367 GCTGCAGGTATGATACAGGACGG + Intergenic
1027371581 7:77511426-77511448 GGTGCAGGGGGTACACATGCAGG - Intergenic
1028113906 7:86975882-86975904 GCTGAAGGTGGGCCAAATCAGGG + Intronic
1029253666 7:99254433-99254455 GCAGCAGGTGGCAGACATAAAGG - Intergenic
1033230492 7:139593829-139593851 GCTCCAGCTGGGACACAGAAGGG + Intronic
1034191172 7:149214512-149214534 GCAGCAGGTGGCTCACATGCTGG + Intronic
1034292747 7:149945699-149945721 CCGGCAGGTGGGACACATGTTGG + Intergenic
1034343611 7:150372614-150372636 GCCGCAGTCGGGACACACGAAGG - Exonic
1034347843 7:150397983-150398005 GCCGCAGGCGGGACACAGGTAGG - Exonic
1034813320 7:154151173-154151195 CCGGCAGGTGGGACACATATTGG - Intronic
1035159474 7:156940685-156940707 GGTGCAGGTGGCACACACTAGGG - Intergenic
1035670245 8:1411585-1411607 CCTGCAGGTGGTAGACTTGAGGG + Intergenic
1036098870 8:5755716-5755738 GCTGAAGGTCAGACACATGGTGG - Intergenic
1036701368 8:11015949-11015971 GCTGCAGGCGGGCTCCATGAGGG + Intronic
1038198380 8:25389069-25389091 TCTGCAGGTGAGACACAGAAAGG - Exonic
1038309981 8:26439057-26439079 GCTACTGGAGGGTCACATGAGGG - Intronic
1039656347 8:39412114-39412136 GCTTCAGGTGTGACACAGCAGGG + Intergenic
1040551230 8:48439085-48439107 CCGGCAGGTGGGACAGATGCAGG + Intergenic
1041795726 8:61745844-61745866 GATTCAGGTGGTACACATGCAGG + Intergenic
1042184341 8:66122023-66122045 GCTGTAAGTGGGACACAGGAGGG - Intergenic
1044898118 8:96914735-96914757 GCTGGAGGTGGGGAACATTATGG - Intronic
1045076880 8:98579274-98579296 GTTGCAGGTGGGACATAAAAAGG - Intronic
1048035648 8:130674800-130674822 GATGCTGGTAGGACACAGGAAGG - Intergenic
1048366856 8:133745827-133745849 GCTGCAGGTGGCACTGAAGATGG + Intergenic
1050244952 9:3679633-3679655 ACTGAAGCTGGGACAAATGAAGG - Intergenic
1051156906 9:14158240-14158262 GCTGCAGGAGGAAGATATGAAGG - Intronic
1051354733 9:16231304-16231326 CCTCCAGGTGGGGCACAGGAAGG - Intronic
1051720075 9:20028234-20028256 GTTGCAGGTGGGGGAAATGAGGG - Intergenic
1053062633 9:35043953-35043975 GATGCTGGTGGGACACATTCAGG - Exonic
1055652708 9:78422450-78422472 GATGTAGGTGGGACAGATGGAGG + Intergenic
1055745222 9:79436894-79436916 GATTCAGGTGGTACACATGAAGG - Intergenic
1056547947 9:87628478-87628500 ACTGAAGCTGGGACACAGGAAGG - Intronic
1057383531 9:94589165-94589187 GGTGCAGGGTGGACACATGAAGG - Intronic
1058113892 9:101063250-101063272 GCTGAAGGTGGAAGAAATGATGG + Intronic
1059067124 9:111097053-111097075 GATGCAGGTGGCACACAACATGG + Intergenic
1060516302 9:124267910-124267932 CCTGTAGGTGAGACACATCATGG + Intronic
1060602754 9:124889048-124889070 GCAGCAGTGGGGACACATGGTGG - Intronic
1062370615 9:136236904-136236926 GCTCCAGGTGTGGCACAGGACGG - Intronic
1062370629 9:136236954-136236976 GCTCCAGGTGTGGCACAGGACGG - Intronic
1062370663 9:136237077-136237099 GCTCCAGGTGTGGCACAGGACGG - Intronic
1062370690 9:136237177-136237199 GCTCCAGGTGTGGCACAGGACGG - Intronic
1062370755 9:136237431-136237453 GCTCCAGGTGTGGCACAGGACGG - Intronic
1062370782 9:136237535-136237557 GCTCCAGGTGTGGCACAGGACGG - Intronic
1062370795 9:136237585-136237607 GCTCCAGGTGTGGCACAGGACGG - Intronic
1062370823 9:136237685-136237707 GCTCCAGGTGTGGCACAGGACGG - Intronic
1062370836 9:136237735-136237757 GCTCCAGGTGTGGCACAGGACGG - Intronic
1062535588 9:137019872-137019894 GATGAGGGTGGGACAGATGAGGG - Intronic
1062647713 9:137557585-137557607 GAGGCAGGTGGATCACATGAGGG + Intronic
1203783336 EBV:113554-113576 GAAGCAGGTGGCACACATTACGG - Intergenic
1188999642 X:36930047-36930069 GATTGAGGTTGGACACATGAAGG - Intergenic
1189273596 X:39768960-39768982 GATTCAGGAGGGCCACATGAGGG + Intergenic
1195554186 X:106202569-106202591 ACTGCAGGGAGGACACATGCAGG - Intronic
1196433427 X:115652304-115652326 GTAGCTGGTGGGACACATTATGG - Intergenic
1197980794 X:132217262-132217284 GGTGAAGGTGAGACTCATGAGGG - Exonic
1200684151 Y:6245121-6245143 GCTGAAGGTGGAAGACATAATGG - Intergenic
1200686778 Y:6265439-6265461 GCTGAAGGTGGAAGACATCATGG - Intergenic
1200989656 Y:9336355-9336377 GCTGAAGGTGGAAGACATCATGG - Intergenic
1200992325 Y:9356688-9356710 GCTGAAGGTGGAAGACATCATGG - Intergenic
1200994976 Y:9376966-9376988 GCTGAAGGTGGAAGACATCATGG - Intronic
1200997641 Y:9397312-9397334 GCTGAAGGTGGAAGACATCATGG - Intergenic
1201000153 Y:9465848-9465870 GCTGAAGGTGGAAGACATCATGG - Intergenic
1201002812 Y:9486158-9486180 GCTGAAGGTGGAAGACATCATGG - Intronic
1201005468 Y:9506441-9506463 GCTGAAGGTGGAAGACATCATGG - Intergenic
1201008131 Y:9526771-9526793 GCTGAAGGTGGAAGACATCATGG - Intergenic
1201010741 Y:9546961-9546983 GCTGAAGGTGGAAGACATCATGG - Intergenic
1201048484 Y:9909265-9909287 GCTGAAGGTGGAAGACATAATGG + Intergenic
1201424379 Y:13832253-13832275 GGTGCAGGTGGGTCAGATAAGGG + Intergenic