ID: 932249562

View in Genome Browser
Species Human (GRCh38)
Location 2:70230878-70230900
Sequence GGGTGAATAAAGCTTAAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 159}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932249562 Original CRISPR GGGTGAATAAAGCTTAAAAT TGG (reversed) Intronic
902675344 1:18004880-18004902 TGGTGAATAAACCTAGAAATTGG + Intergenic
904907142 1:33906194-33906216 GGGTTAATAAAATTTAAAAAAGG + Intronic
906595617 1:47074109-47074131 GGGTGAAAGAAGCCTAAAGTAGG + Intronic
907754076 1:57292914-57292936 GGGTTAATAAAGCTTCAAAGAGG + Intronic
909041894 1:70663452-70663474 TAGTGAATATAGCTTAAAAATGG - Intergenic
909684692 1:78334359-78334381 GTCTCAATAAATCTTAAAATAGG - Intronic
912745037 1:112239136-112239158 GGGAGAATCAGGCTGAAAATGGG + Intergenic
914907586 1:151759341-151759363 GGATGAAAGAAGCTTAAAAAGGG - Intergenic
917307917 1:173645894-173645916 CTGTGATTAAAGGTTAAAATTGG - Intronic
918878167 1:190077575-190077597 GTGTGAACAAAGCTGAGAATTGG + Intergenic
919088570 1:192950588-192950610 GAATGAATAAAACTTAAAGTAGG - Intergenic
919530530 1:198713487-198713509 GGGTGAATAAAAATGAACATGGG + Intronic
922936854 1:229429811-229429833 GGGTGGATGAAGGTTAAAAATGG - Intergenic
924315299 1:242789325-242789347 AAGGGAAAAAAGCTTAAAATAGG + Intergenic
924404323 1:243726696-243726718 GGATATATAAAGCTGAAAATGGG + Intronic
1063041730 10:2346982-2347004 CAATGAATAAAACTTAAAATCGG + Intergenic
1068230178 10:54161378-54161400 GGGTGTCTACAGCTGAAAATGGG + Intronic
1069151963 10:64973750-64973772 GAATGAATAAATGTTAAAATTGG + Intergenic
1071843227 10:89494798-89494820 GTGGGAATGAAGCTAAAAATAGG + Intronic
1074830828 10:117247447-117247469 GGAAGAACAAAGCTTGAAATGGG - Intronic
1075010680 10:118867289-118867311 AAGTAAATAAAGCATAAAATGGG + Intergenic
1079463984 11:20711226-20711248 GGGTGGAAAAAGCTCATAATAGG - Intronic
1083164921 11:60878241-60878263 GGAGGAAGAAAGCTTTAAATTGG - Intergenic
1083673113 11:64310880-64310902 GGGTGCACAAAGTTTAAGATTGG - Intronic
1085364310 11:75924935-75924957 AGGTGAATGAAGAATAAAATAGG + Intronic
1086830072 11:91551176-91551198 GGGTTATTACATCTTAAAATTGG - Intergenic
1087287485 11:96280859-96280881 GGGAGCTTATAGCTTAAAATGGG - Intronic
1091115343 11:133007204-133007226 GGGGCAACAAAGCCTAAAATAGG - Intronic
1091846311 12:3658659-3658681 GGCAGCATAAAACTTAAAATTGG + Intronic
1094049343 12:26201931-26201953 GACTGAATATAGCTTAAAAATGG - Intronic
1095646234 12:44551304-44551326 GGGTGAATAAATCAGAAAACAGG - Intronic
1095914106 12:47458570-47458592 GGGTGAATGAAGGTGAAATTTGG + Intergenic
1099146445 12:79051160-79051182 GGTTGAAAAAAGATTAAATTTGG - Intronic
1106226309 13:27789724-27789746 GGGTGACTAAAGTTCAAACTCGG + Intergenic
1106983134 13:35313909-35313931 AGGTGAATAAGGTTTAAATTTGG + Intronic
1107718521 13:43224432-43224454 TGGTAAATCAAGCATAAAATTGG - Intronic
1108939121 13:55927971-55927993 GGTAAAATAAAGTTTAAAATAGG + Intergenic
1109410877 13:61967245-61967267 TGTTGATTAAAGCTTAAATTTGG + Intergenic
1111085139 13:83366034-83366056 TGGGGAAAGAAGCTTAAAATTGG - Intergenic
1111203681 13:84974256-84974278 GGAAGAATAAGGATTAAAATAGG + Intergenic
1114371977 14:22099771-22099793 GGGTGTATGATGCTTAAATTAGG - Intergenic
1116029433 14:39553038-39553060 GGATGATTAAAGCTGATAATTGG + Intergenic
1116831218 14:49721830-49721852 GGGTGCAGAAAGCATAAAGTGGG - Intronic
1120925158 14:89790454-89790476 GGATCAGTAAAGCATAAAATAGG + Intergenic
1124444129 15:29714053-29714075 GAGTGAATGAAGCTCAAAACAGG - Intronic
1130797243 15:87222683-87222705 GGGAGAATAAAACTTAAAGATGG - Intergenic
1131138325 15:89956277-89956299 GGGAAAAAAAAGTTTAAAATTGG + Intergenic
1138336876 16:56260389-56260411 GTGTGAATCAAGCCTAAAATTGG - Intronic
1139212209 16:65090442-65090464 GGGAGAATAAGGCTTAAGAAAGG - Intronic
1141363762 16:83423112-83423134 GGGTCAATATAGCAGAAAATGGG - Intronic
1146897249 17:36552642-36552664 GGGTTGATAAACCTGAAAATTGG + Intronic
1147043798 17:37738051-37738073 TGCTGCATAAAGCTTAAATTGGG + Intronic
1152999863 18:444651-444673 GGGAGAGAAAAGGTTAAAATAGG + Intronic
1155040271 18:22059562-22059584 GGATGAATAAAGATTATTATTGG + Intergenic
1155878632 18:31117075-31117097 GGGTGAGGCAGGCTTAAAATGGG + Intergenic
1156780966 18:40850227-40850249 GGGTAAATAAAGCAGAAAACAGG + Intergenic
1158049023 18:53193157-53193179 AAGTGAAAAATGCTTAAAATGGG + Intronic
1159988920 18:74879076-74879098 GTATGTATAAATCTTAAAATAGG + Intronic
1162247109 19:9410583-9410605 GGGTGAACACAGCTCAACATTGG + Intergenic
1164771678 19:30814507-30814529 TGGTGAATAAATATGAAAATAGG - Intergenic
926445485 2:12936493-12936515 GGGGGAACAAAACTCAAAATAGG - Intergenic
927628620 2:24750899-24750921 GTCTGAATAAAGCTTAAAAGGGG + Intronic
928040596 2:27872602-27872624 GGGAGAAAAAAGGTTAAACTCGG + Intronic
929250789 2:39752882-39752904 AGGAGAATAAACCTTAAAACAGG - Intronic
929714487 2:44296530-44296552 GGGTGAATAACTCTTATCATGGG - Intronic
930646470 2:53914429-53914451 TGTTGAATTAATCTTAAAATAGG - Intronic
931086450 2:58836233-58836255 GGCTGAATAAAGTATAAAGTTGG - Intergenic
932249562 2:70230878-70230900 GGGTGAATAAAGCTTAAAATTGG - Intronic
932441120 2:71736260-71736282 GGGTTTACACAGCTTAAAATGGG - Intergenic
932949730 2:76278971-76278993 TGGTTAATATAGCTTCAAATAGG + Intergenic
933320648 2:80771783-80771805 GGGTTAATAAAATTTACAATAGG + Intergenic
933600294 2:84321997-84322019 GGCTGGATAAAGCTTTACATAGG - Intergenic
934138048 2:89017063-89017085 GGGTGATTAAACAATAAAATGGG - Intergenic
934231196 2:90183563-90183585 GGGTGATTAAACAATAAAATGGG + Intergenic
936847222 2:116851872-116851894 GAGTTAATAATGCTTGAAATAGG - Intergenic
937403629 2:121607675-121607697 GTGTGAAAAAAGCTTCAATTTGG - Intronic
941757934 2:169208353-169208375 GGTTAAATAAAGCTTTAATTGGG - Intronic
943018743 2:182547107-182547129 GGGTAAATACATCTAAAAATAGG + Intergenic
943257987 2:185620807-185620829 AGATGAATAAAGCATACAATGGG - Intergenic
944338847 2:198570668-198570690 GACTGAATAAAGATTAAAATAGG + Intronic
1168889373 20:1284406-1284428 GACTAAATAAAGCATAAAATGGG + Intronic
1170394210 20:15908481-15908503 GGGTGTAAAAAGTTTAATATGGG - Intronic
1170960991 20:21025903-21025925 GGGTGAATAAGGCTTCCTATGGG - Intergenic
1176419117 21:6499776-6499798 GGGTTTATAAAGCTTAAGAGGGG + Intergenic
1177668258 21:24190216-24190238 GGGACAAAAAGGCTTAAAATGGG - Intergenic
1179694610 21:43108098-43108120 GGGTTTATAAAGCTTAAGAGGGG + Intergenic
1182035676 22:27196500-27196522 GGGTGATTAAGGGATAAAATGGG + Intergenic
1182218984 22:28742727-28742749 GGGTGAGTAAGGTTTAAAGTTGG + Intronic
1184450668 22:44580660-44580682 GGGTGAAGCAAGCTAAAAACGGG - Intergenic
1184629956 22:45769386-45769408 GGGAGAATCAAGCATGAAATGGG + Intronic
950952474 3:17015009-17015031 AGGTGAATGAAGCATGAAATAGG - Intronic
952149320 3:30569805-30569827 GGGTGCATATATATTAAAATTGG - Intergenic
952449662 3:33419911-33419933 GAGAAAATAAAGCTAAAAATAGG - Intronic
956528447 3:70190262-70190284 GGGTGATGAAGGCTTGAAATAGG - Intergenic
956807423 3:72829147-72829169 GGGTGAATAGAGTGAAAAATGGG + Intronic
957913007 3:86647151-86647173 GGGGGAACAAAACTAAAAATGGG + Intergenic
960496202 3:118378029-118378051 GGAAGAATACAGATTAAAATTGG - Intergenic
960918387 3:122721111-122721133 GCGTGAATAAAGCTAGAATTAGG - Intronic
962353162 3:134670747-134670769 GAGTTCATAAAGCTTAAAAATGG + Intronic
962661490 3:137605253-137605275 CAGTGAATAAAGCTGAGAATGGG - Intergenic
963562769 3:146887168-146887190 AAGTGAATAAAGCATAAAGTTGG + Intergenic
964311443 3:155397888-155397910 GATTAAATAAATCTTAAAATAGG - Intronic
965321701 3:167259929-167259951 GTGTGAATTAAGCTTTAAACAGG + Intronic
967681674 3:192370940-192370962 GGGTGAAGAAAGCTTAACGCAGG + Intronic
971412871 4:26393802-26393824 GGGTGCAGAGAGTTTAAAATTGG + Intronic
974243769 4:59286570-59286592 GTCTGAATGAAGCTTAAAAAGGG - Intergenic
975137664 4:70890167-70890189 GGGAGAATATAGCTTGAACTAGG + Intergenic
976043073 4:80911280-80911302 GAGTGAAAAAAGGTAAAAATGGG - Intronic
976769230 4:88633861-88633883 TAGTGAGTAAAGCTTAAAGTAGG + Intronic
976978806 4:91197967-91197989 GAGTGAATAATTCTTAAAAATGG + Intronic
977869531 4:102074049-102074071 GGGTGAAGCAAGCTTGAATTTGG + Exonic
978505422 4:109451136-109451158 GATTGAATAAATTTTAAAATGGG - Intronic
980782295 4:137506896-137506918 GAGTGAATAGCTCTTAAAATTGG - Intergenic
982584906 4:157223139-157223161 ATATGACTAAAGCTTAAAATGGG - Intronic
982910435 4:161135082-161135104 GGGTGAATAAACTTTAAAAGTGG + Intergenic
983796292 4:171868309-171868331 ACATGAAGAAAGCTTAAAATGGG - Intronic
985753676 5:1699863-1699885 AGGGGAAAAAAGCTTAAGATTGG - Intergenic
986591047 5:9370836-9370858 GGGTGAGTAAAGTTTTAATTAGG - Intronic
986701236 5:10411092-10411114 GGCTGAAGAAAACGTAAAATAGG + Intronic
989699661 5:44247627-44247649 GGGGAAATAGAACTTAAAATAGG + Intergenic
990506695 5:56452193-56452215 GCGTGTATACAGCTTTAAATTGG - Intergenic
991660397 5:68945334-68945356 TTAAGAATAAAGCTTAAAATAGG - Intergenic
992948755 5:81835844-81835866 GGATGAAAAAAGCTTATAAATGG + Intergenic
994779437 5:104070512-104070534 GGGTGGTTATAGCTTAAAAATGG - Intergenic
994796227 5:104303764-104303786 GTGTGACTAAATCTAAAAATGGG - Intergenic
994980626 5:106871707-106871729 GGAAGCAGAAAGCTTAAAATTGG + Intergenic
995616266 5:113967667-113967689 GGGAGAAAAAAACTAAAAATAGG - Intergenic
996628008 5:125593520-125593542 GGGAGAAAAGAGCTTGAAATGGG + Intergenic
1004429082 6:15527687-15527709 AGGGGAAAAAAGCTTAAAAATGG + Intronic
1005737253 6:28759451-28759473 GGGTGGATAAAGACTAAAAAGGG + Intergenic
1008162331 6:48093655-48093677 AGGTGATTAAAGATTAAAAGTGG - Intergenic
1008499302 6:52164803-52164825 GTGTGAAGAGAGCTTAGAATAGG + Intergenic
1009670301 6:66740406-66740428 GGGAGAATAAATCCTAAAATGGG - Intergenic
1012514746 6:100046291-100046313 TGATGCATAAAGCTCAAAATAGG - Intergenic
1012898819 6:104983271-104983293 GAGTGAAGATAGCTCAAAATTGG + Intronic
1015656016 6:135520003-135520025 GGGTAAATAAGGCTTAAAGGAGG - Intergenic
1015725908 6:136299417-136299439 TGGTGCATAAAACTGAAAATTGG + Intergenic
1016880491 6:148906405-148906427 GGGTGAATATAGCAAAAAGTGGG + Intronic
1018241339 6:161778301-161778323 GTGTGAATGAAGCTGCAAATGGG - Intronic
1018442687 6:163827666-163827688 GGATGAATAATGATTAATATTGG + Intergenic
1022733171 7:33051060-33051082 AAGAGAATAAAGATTAAAATAGG + Intronic
1032381949 7:131493965-131493987 GGAGAAATAAAGCTCAAAATTGG - Exonic
1032459068 7:132095896-132095918 GGGTGAAGAAAGGTAGAAATAGG + Intergenic
1034862063 7:154605951-154605973 GGGTAAATAAAGCATATATTCGG - Intronic
1037228013 8:16619355-16619377 TGGTGAACAAAACTGAAAATTGG - Intergenic
1038475751 8:27866223-27866245 GGATGAACAAAGCTAAAAGTTGG - Intergenic
1041336808 8:56794596-56794618 GGTTGAATAAAGTATAAATTAGG - Intergenic
1041483047 8:58344523-58344545 AGGGGAGTTAAGCTTAAAATTGG - Intergenic
1042613499 8:70623817-70623839 AAGTCAATAAAGCCTAAAATTGG - Intronic
1043425923 8:80148715-80148737 AAGAGAATAAAGCTTGAAATTGG - Intronic
1045632090 8:104136383-104136405 TGGTAAATAATTCTTAAAATTGG - Intronic
1045934240 8:107660346-107660368 AGGTGAATAAACCATCAAATTGG - Intergenic
1046749684 8:117913866-117913888 GGTTAAATAAAGCTGAATATGGG + Intronic
1051046849 9:12886278-12886300 GAGAGAATAAAGCACAAAATAGG - Intergenic
1052681980 9:31704979-31705001 AGGTGTATAAAGCTTAAGAAAGG - Intergenic
1055219560 9:73912190-73912212 GGGTGAATAAAGATCAAACCAGG + Intergenic
1060378850 9:123145265-123145287 AGGTGAATAAAACATAATATTGG + Intronic
1185524298 X:765069-765091 AGGTAAATAAAGGTTAAAAAAGG + Intergenic
1192030333 X:67504909-67504931 GGCTGAAAAAATCCTAAAATTGG + Intergenic
1194771564 X:97913048-97913070 GGGGAAATAAAGCATGAAATAGG + Intergenic
1195304368 X:103565334-103565356 GGATGACAAAGGCTTAAAATGGG - Intergenic
1198192521 X:134323753-134323775 GGGTGACAAAATCATAAAATGGG - Intergenic
1199290462 X:146099480-146099502 GAGTGAACAATGGTTAAAATAGG + Intergenic
1202245635 Y:22817322-22817344 GAGTGAATAAAGCACAAAGTTGG + Intergenic
1202398624 Y:24451070-24451092 GAGTGAATAAAGCACAAAGTTGG + Intergenic
1202472157 Y:25219016-25219038 GAGTGAATAAAGCACAAAGTTGG - Intergenic