ID: 932252672

View in Genome Browser
Species Human (GRCh38)
Location 2:70258222-70258244
Sequence TGCAGCTGCGGATGCCCCGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 103}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932252669_932252672 6 Left 932252669 2:70258193-70258215 CCTCGCTGCTGGGGTTGTGGCTG 0: 1
1: 0
2: 1
3: 32
4: 344
Right 932252672 2:70258222-70258244 TGCAGCTGCGGATGCCCCGAGGG 0: 1
1: 0
2: 0
3: 8
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932252672 Original CRISPR TGCAGCTGCGGATGCCCCGA GGG Exonic