ID: 932252918

View in Genome Browser
Species Human (GRCh38)
Location 2:70259777-70259799
Sequence TGGAATTACAGCCATGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 215}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932252918 Original CRISPR TGGAATTACAGCCATGGGGT GGG Intronic
900213658 1:1469466-1469488 CTTGATTACAGCCATGGGGTGGG + Exonic
900221219 1:1510271-1510293 CTTGATTACAGCCATGGGGTGGG + Intergenic
900405121 1:2489622-2489644 TGGCATCTCAGCCATGGGGCAGG - Intronic
902665018 1:17931394-17931416 AGGAATTACAGCCATGGAGGCGG - Intergenic
903579010 1:24357282-24357304 TGGAACCACAGCCATGCTGTAGG + Exonic
904328430 1:29742583-29742605 TGGAACCATGGCCATGGGGTGGG - Intergenic
906906922 1:49904884-49904906 TGAAATTACAGCTGTGGGGTTGG + Intronic
910115108 1:83723547-83723569 TGGAATTCCTCCCCTGGGGTAGG + Intergenic
910297133 1:85659485-85659507 TGGAGTTACAGCCATTAGGCTGG - Intronic
912022823 1:105127362-105127384 TGTAATCCCAGCCATTGGGTGGG + Intergenic
913157811 1:116117230-116117252 TGGAATTACATCCGTGGGGCTGG + Intronic
915145845 1:153795335-153795357 GGGAATCAAAGCCATGGGGGAGG + Intergenic
916179475 1:162070944-162070966 TGGAATTTCAGCGCTGAGGTCGG + Intronic
917175177 1:172226259-172226281 TGGCATAACAGCTAGGGGGTTGG - Intronic
917733569 1:177900382-177900404 TGGGATTACAGCCACTGGGTTGG - Intergenic
918340223 1:183562563-183562585 TGGGATTACAGACATGAGCTGGG - Intronic
918663181 1:187114749-187114771 TGGAATTACAGTTAGGAGGTTGG + Intergenic
919127141 1:193408848-193408870 AGCAATTCCAGCCATGGGTTTGG - Intergenic
920580636 1:207104249-207104271 CTGAATTTCAGCCATGTGGTTGG - Exonic
924095828 1:240549860-240549882 ATGAATTAGAGCCATGAGGTGGG + Intronic
924498113 1:244609769-244609791 TGGGATTACAGGCATGTGCTTGG - Intronic
924504083 1:244664561-244664583 TGGAATCACAGGCATGGGCCTGG - Intronic
924948961 1:248865287-248865309 TGGGATTACAGGCATGAGTTGGG + Intergenic
1063746018 10:8882433-8882455 TGGAATTACAGGCATGAGCCTGG + Intergenic
1064141370 10:12793361-12793383 TGAAGTTACAGCCTTGGGGTGGG + Intronic
1065291124 10:24230798-24230820 TGGGATTACAGGTGTGGGGTAGG + Intronic
1066678650 10:37914807-37914829 TGGAAACACAGCAATGGGGCCGG - Intergenic
1067691414 10:48504481-48504503 TGGGATAACAGAAATGGGGTGGG + Intronic
1068547150 10:58360478-58360500 TGGAATTACAACCCAGGGGCGGG + Intronic
1068566627 10:58583003-58583025 TGGAGTTTAAGCCATGTGGTAGG - Intronic
1068583203 10:58766257-58766279 TGGATATAGTGCCATGGGGTGGG + Intronic
1069975891 10:72212711-72212733 TGGGATTACAGCCATGTGCCAGG - Intronic
1070932126 10:80268499-80268521 TGGGATGAAAGGCATGGGGTGGG - Intergenic
1071387750 10:85139515-85139537 TCCAATTACAGCCAAGGTGTGGG + Intergenic
1073882412 10:107998442-107998464 TGGAATTACAGCTGAGGTGTGGG - Intergenic
1075565087 10:123497432-123497454 TACAATTACAGCCAGGGGGTGGG + Intergenic
1077677567 11:4209873-4209895 TGGAATTATGGCTATGGGCTTGG + Intergenic
1078493476 11:11791622-11791644 TGGAATTCCAGCTATTCGGTAGG + Intergenic
1080428123 11:32174500-32174522 TGGTTTTCCAGCAATGGGGTAGG - Intergenic
1081299893 11:41437914-41437936 TGTAATTCCAGCCATGTGGGAGG + Intronic
1081470782 11:43368545-43368567 TGGAATTACAGAAATGGAGGTGG - Intronic
1082232872 11:49790415-49790437 CGGAAGTACAGCCAGTGGGTAGG + Intergenic
1083972338 11:66086884-66086906 TGGGATTACAGGCGTGGGGCCGG + Intronic
1084002297 11:66303022-66303044 TAGAATTAAGGCCATGGGGCTGG + Intergenic
1084097410 11:66920746-66920768 TGGAAATACAGGCATGAGGCTGG + Intronic
1085041042 11:73326434-73326456 TGGGATTACAGCCGTGAGCTTGG - Intronic
1085387967 11:76167997-76168019 GGGCCTTACAGCCCTGGGGTGGG - Intergenic
1086617756 11:88843502-88843524 CGGAAGTACAGCCAGTGGGTAGG - Intronic
1086924904 11:92629794-92629816 TGGAATGAGAGACATGGGGCAGG - Intronic
1088702079 11:112422399-112422421 TGGAGTTACAACCATGCAGTGGG - Intergenic
1095367488 12:41425340-41425362 TGGAAGTATAGCCAAGGAGTAGG + Intronic
1095413806 12:41953440-41953462 TGGAATTGCTGCCTTGGGGAGGG + Intergenic
1096044525 12:48551358-48551380 TGCAATTGCAGGCATTGGGTAGG - Intergenic
1096341561 12:50805078-50805100 TGGGATTACAGGCATGAGCTTGG + Intronic
1096671672 12:53202622-53202644 TGGGATTACAGGCATGAGCTGGG + Intronic
1098834629 12:75407160-75407182 GGGATTTATAGCCATGGAGTAGG - Intronic
1099845088 12:88018867-88018889 TGGGGTTACAGGCATTGGGTAGG - Intronic
1102030682 12:109738466-109738488 TTGAATTACAGCCAGAGGGATGG + Intronic
1102047829 12:109840861-109840883 TGGAATCACAGCCAGTGGCTGGG - Intergenic
1102800194 12:115725672-115725694 TGGCATTAAACCCATGGGGCTGG + Intergenic
1104668561 12:130665253-130665275 TGGGATTACAGGCATGAGCTGGG - Intronic
1106324839 13:28678983-28679005 TGGAGTTACAACTTTGGGGTTGG + Intergenic
1108824492 13:54395765-54395787 TGGATTTATAGCCAAGGAGTGGG + Intergenic
1110175400 13:72549851-72549873 TGGAATTCCAGCCATGCTCTAGG - Intergenic
1111203759 13:84975611-84975633 TGGAATGAGAGCAATGGTGTGGG - Intergenic
1112557826 13:100485178-100485200 TGTCATTAAAGCAATGGGGTGGG - Intronic
1114879619 14:26768374-26768396 TGGGATTACAGCCATGTGCCAGG - Intergenic
1117832139 14:59762216-59762238 TTGAATTACTGGCCTGGGGTTGG + Intronic
1119174257 14:72557565-72557587 TGGAATTAGAGGCCTGGGGTGGG - Intronic
1119234453 14:73007670-73007692 TGAAATTTAGGCCATGGGGTTGG - Intronic
1120579344 14:86227115-86227137 TGTATTTACAACCATGGGGAAGG - Intergenic
1121059867 14:90896990-90897012 TGGAATTACAGGCATGAGCCAGG + Intronic
1126825480 15:52543757-52543779 TGGGATTACAGGCATGAGGTGGG + Intergenic
1129357542 15:75001599-75001621 TGGGATTACAGCCATGAGCCAGG - Intronic
1131285379 15:91052579-91052601 TGGAAGAACAGAGATGGGGTGGG - Intergenic
1132049290 15:98593502-98593524 TGGAATTACAGGCATGTGCCAGG - Intergenic
1132207676 15:99997667-99997689 TGGAATTGCTGCCCTGTGGTGGG + Intronic
1134168438 16:11949005-11949027 TGGGATTACAGGCATGCGGCAGG - Intronic
1134386380 16:13777335-13777357 TGGAATTACAGGCATAGGCTTGG - Intergenic
1134747926 16:16602265-16602287 TGGGATTACAGGCATGTGGAAGG + Intergenic
1134807568 16:17138923-17138945 TGGAATTTCACCCCTGGGGTAGG + Intronic
1134997543 16:18751394-18751416 TGGGATTACAGGCATGTGGAAGG - Intergenic
1135134893 16:19880318-19880340 TGGGATTACAGGCATGAGCTTGG - Intronic
1135833456 16:25799957-25799979 TGGAATTCCAGCTATGCGGAAGG - Intronic
1140198526 16:72875834-72875856 TGGAATTCCAGCCCTGGGACCGG - Intronic
1141209776 16:81966904-81966926 TGAAATTGATGCCATGGGGTGGG - Intergenic
1142521422 17:507552-507574 TGGAATTAGAGCATCGGGGTTGG - Intergenic
1142857896 17:2742654-2742676 AGTATTTACAGCCATGGGATGGG - Intergenic
1143885389 17:10061335-10061357 CAGAATTACAGCATTGGGGTTGG + Intronic
1144228638 17:13176586-13176608 TGGAATGACAGCAATGGGAGAGG - Intergenic
1144417833 17:15068567-15068589 TGGAATTACAGGCATGAGCCCGG + Intergenic
1145277813 17:21445279-21445301 TGTAATCACAGCCATGGACTGGG - Intergenic
1145315642 17:21731158-21731180 TGTAATCACAGCCATGGACTGGG - Intergenic
1145714078 17:27003097-27003119 TGTAATCACAGCCATGGACTGGG - Intergenic
1145928302 17:28664581-28664603 GGTAATTAAAGCCATGGGGCTGG - Intronic
1146655941 17:34635202-34635224 TGGAATTTCAGACAAGGGGCAGG - Intronic
1148572853 17:48684409-48684431 TAGAATTACAGGCATGAGGCCGG + Intergenic
1149171821 17:53821359-53821381 TGGAATTACAGGCATGTGTCAGG - Intergenic
1150060094 17:62060351-62060373 TGGGATTACAGGCAGGAGGTAGG - Intronic
1150668792 17:67171247-67171269 TGGATTTACAGCCCTGAGCTGGG - Intronic
1150771688 17:68047339-68047361 TGGGATTACAGGCATGGTGGTGG + Intergenic
1151647805 17:75445413-75445435 AGGAACTACACCCATGGGATGGG - Intronic
1152258853 17:79255766-79255788 GGGAATTGCAGCCATGGAGGAGG - Intronic
1153650683 18:7237248-7237270 TGGCATTACTGCAATGGTGTGGG + Intergenic
1155295523 18:24381187-24381209 TGGGATTATAGCCAAGGAGTAGG + Intronic
1157968544 18:52238343-52238365 TGGAATTACAGGCACGAGGTGGG - Intergenic
1158361295 18:56676881-56676903 TGGAATTACAGGCATGAGCCAGG + Intronic
1158885633 18:61824385-61824407 TGGCAGTACTGCCATGCGGTTGG - Intronic
1158956793 18:62547826-62547848 TGGGATTACAGACATGGTGTGGG + Intronic
1160097941 18:75892333-75892355 AGGAGTTACAGCCCTGGTGTGGG - Intergenic
1162461619 19:10817196-10817218 GACATTTACAGCCATGGGGTGGG + Intronic
1165077147 19:33286155-33286177 AGGAATTCCAGCCATGGGGCGGG - Intergenic
1166236074 19:41457958-41457980 TGAAATTACAGCTATGTGTTTGG - Intergenic
1166622523 19:44314519-44314541 GGCAATTCCAGCCATGGGTTTGG + Intergenic
1167004073 19:46764216-46764238 TGGAATTACAGGCATGAGCCTGG + Intronic
927498370 2:23565469-23565491 TGGAGTCCCAGCCAAGGGGTAGG - Intronic
927907478 2:26870574-26870596 TGGGATTACAGCCATGTGCATGG - Intronic
928267829 2:29826858-29826880 GAGAATTACAGCCATGAGCTTGG - Intronic
931135829 2:59399481-59399503 TGGCATTGCAGACATGGGGTTGG - Intergenic
932252918 2:70259777-70259799 TGGAATTACAGCCATGGGGTGGG + Intronic
932825336 2:74933836-74933858 TGAAGTGACAGCCATGGGGGAGG + Intergenic
932963568 2:76443834-76443856 TGGAATTACAGCCATCAGCCTGG - Intergenic
935206802 2:100903225-100903247 TGGAAGCACAGGCTTGGGGTAGG + Intronic
935316007 2:101834426-101834448 TGGCATTACAGCCATTGAGATGG + Exonic
937665240 2:124479665-124479687 AGCAATTTCAACCATGGGGTTGG - Intronic
937702223 2:124876478-124876500 TGCAGTTATAGCCATGGGCTAGG + Intronic
938583094 2:132665578-132665600 TGGTATTACAGCAAAGGTGTTGG + Intronic
938776949 2:134550405-134550427 TGCAATGCCAGCCATGTGGTAGG - Intronic
939708010 2:145479045-145479067 TTGAGTTCCAGCCATGGGGATGG + Intergenic
939737249 2:145862956-145862978 TGGTATTAAAGCCATTGGGTTGG - Intergenic
942772347 2:179537165-179537187 TGGAATTACAGGCATGTGCCCGG - Intronic
943336667 2:186623555-186623577 TATACTTACAGCCATGGGTTAGG - Intronic
944737012 2:202576186-202576208 TGGAATAATAGACATTGGGTGGG - Intergenic
945016587 2:205524843-205524865 TGGAAATAGTGCCATGGGTTGGG - Intronic
945366072 2:208956148-208956170 TGGAATTCTAGCCATGAGATAGG + Intergenic
948017430 2:234701893-234701915 GAGAATCAGAGCCATGGGGTCGG + Intergenic
1169442442 20:5643969-5643991 TGGCATTAAAGCCATGGGATTGG - Intergenic
1169540935 20:6598990-6599012 TGGGATTACAGACATGAGCTGGG - Intergenic
1171145951 20:22782840-22782862 TGGAATCCCAGCTATGCGGTAGG - Intergenic
1172721728 20:37004203-37004225 TGGGATTACAGGCATGTGCTGGG + Intronic
1173649655 20:44654999-44655021 TGGCATTTCAGCAATGTGGTGGG - Intergenic
1173924126 20:46768192-46768214 TGGAATGACAGCCACGTGGAGGG - Intergenic
1175810484 20:61854874-61854896 TGACATTACAGCCCTGGGGCAGG - Intronic
1181485357 22:23227438-23227460 TGGAATTGCAGCCATCCTGTAGG + Intronic
1182349605 22:29691943-29691965 TGGAAGCAGAGCCATGGGGGTGG + Intronic
1182761192 22:32723640-32723662 TGGAATTTCAGCTCTGGGCTCGG + Intronic
1184433149 22:44453505-44453527 GGAAATTGCAGACATGGGGTGGG - Intergenic
1185169144 22:49282257-49282279 TGGAATAACAGCCAGGGAGCTGG - Intergenic
1185228177 22:49665067-49665089 TGGAAATCCAGCCATGAGGCAGG + Intergenic
949501101 3:4680707-4680729 TGGAATTTCAGCCATAGAATGGG + Intronic
951089248 3:18552987-18553009 TGGATTTACTGCCATGAAGTAGG - Intergenic
951355355 3:21660444-21660466 TGGAAATAGAGCCATGGGGACGG + Intronic
952914562 3:38223850-38223872 TGGAATTACAGCAATTGAATTGG + Exonic
953726189 3:45401230-45401252 TGGAATTACAGGCATGAGCCAGG - Intronic
953924012 3:46971687-46971709 AGGAATTTCAGGCATGGAGTTGG - Intronic
954221107 3:49154474-49154496 TGGAATTATCACCATGGGGAAGG - Intergenic
954267105 3:49478323-49478345 TGGGATTACAGGCATGAGATCGG - Intronic
955690426 3:61585411-61585433 TGGTACTATAGCCATTGGGTGGG + Intronic
955692451 3:61604053-61604075 TGGGATTACAGGCATGAGCTGGG - Intronic
956412226 3:68991670-68991692 TGGGATTACAGCCATGAGCCTGG - Intronic
959732527 3:109620308-109620330 TGGGATTACAGGCATGAGCTCGG + Intergenic
960103007 3:113764845-113764867 TGGGATTACAGGCATGAGCTAGG - Intronic
960700027 3:120430237-120430259 GGGAATCACAGCCATCTGGTAGG + Intronic
963059597 3:141214512-141214534 AGGGACTTCAGCCATGGGGTGGG - Intergenic
963162341 3:142163698-142163720 TGAAATTACACCCATTGGCTGGG + Intronic
966056011 3:175690606-175690628 TTAAATTCCAGCCATAGGGTAGG + Intronic
966774055 3:183528582-183528604 TGGAAGTCCAGCCGTGGGGAGGG - Intronic
967566290 3:190977368-190977390 TGGATTTTCAGCTATGGGGAGGG + Intergenic
968096028 3:195931461-195931483 TGGGACTGCTGCCATGGGGTAGG - Intergenic
969082091 4:4626804-4626826 TGGAATTAGAGACCTGGGTTAGG + Intergenic
973830598 4:54755483-54755505 TGGAATTAAAGAAAAGGGGTGGG + Intergenic
978843639 4:113245937-113245959 TGGAATTACAGGCATGTGCCTGG + Intronic
978997097 4:115170300-115170322 TGGGATTACAGGCATGAGGCTGG - Intergenic
979928664 4:126601695-126601717 TGGTATTAAAGCCATGGGGCTGG + Intergenic
980516800 4:133874527-133874549 TGGAATTAAAGGCATGTGGTTGG - Intergenic
981012833 4:139943454-139943476 TGTAATTGGAGCCATAGGGTGGG + Intronic
981681843 4:147408382-147408404 TGGAATGACAGGCATGAGGGGGG - Intergenic
985774481 5:1833739-1833761 TGGACTTCCAGCCTGGGGGTTGG + Intergenic
986586795 5:9326521-9326543 TGGGATTACAGGCATGAGGGAGG + Intronic
987243353 5:16023864-16023886 TGGAATTGCAGATTTGGGGTTGG + Intergenic
987357457 5:17077145-17077167 TGGAATTACAGGCATGAGCCTGG - Intronic
989317777 5:40102675-40102697 CGTAGTTACTGCCATGGGGTTGG + Intergenic
989624596 5:43417110-43417132 TGGAATTACAGCCTTATGGGAGG + Intergenic
990257950 5:53991045-53991067 TGGAATTATACCCATGGGGTGGG - Intronic
990323978 5:54656563-54656585 TGGAATAACAGCTCTGGGCTTGG + Intergenic
992754744 5:79893725-79893747 ATGAATTTCAACCATGGGGTGGG - Intergenic
993987216 5:94611647-94611669 TGGGATTACAGGCATGAGGCTGG + Intronic
994417904 5:99498132-99498154 TGGGATTACAGGCATGAGCTAGG + Intergenic
994462060 5:100077020-100077042 TGGGATTACAGGCATGAGCTAGG - Intergenic
995360259 5:111289049-111289071 TTGAAATACAGGCATGGGCTGGG + Intronic
996334988 5:122373841-122373863 TGGATTTACACCCAAGGGGTGGG - Intronic
997456079 5:134018527-134018549 TGGACTCACAGCCTTGGCGTGGG + Intergenic
1001938380 5:175723420-175723442 TGCTCTTAGAGCCATGGGGTCGG + Intergenic
1005140151 6:22622681-22622703 TGGTAATACAGCAATGGGGGTGG + Intergenic
1005641210 6:27798302-27798324 AGCAAAGACAGCCATGGGGTGGG - Intergenic
1006167487 6:32073576-32073598 TGGAAGAAGGGCCATGGGGTGGG + Intronic
1008745899 6:54669384-54669406 TGGGATTACAGCCATGAGCCTGG - Intergenic
1011091802 6:83611205-83611227 TTTTATTACAGCCATGGGGGGGG - Intronic
1011741121 6:90361846-90361868 TGGAAATACAGCCTTGGAGATGG - Intergenic
1017735588 6:157360004-157360026 AGGAATGACAGCGATGGGGAGGG + Intergenic
1018222609 6:161596035-161596057 GGGACTTGCAGACATGGGGTCGG + Intronic
1019599265 7:1873340-1873362 TGTAATTACAGCAAGAGGGTGGG + Intronic
1019873800 7:3791278-3791300 TGGAACTACAGCCAGTGAGTAGG + Intronic
1021791047 7:24205854-24205876 TGGAATTGAAGCCATGGGATGGG + Intergenic
1022417848 7:30193279-30193301 TGGCATGAGAGCCATGGGCTTGG + Intergenic
1022785111 7:33630936-33630958 TGGGATTACAGCCAAGTGGGGGG + Intergenic
1023264965 7:38394679-38394701 TGAAATTACAGCCCTGTGTTTGG - Intronic
1027238780 7:76314062-76314084 AGGAAGTGCAGTCATGGGGTGGG - Intergenic
1028110464 7:86934673-86934695 GGCAATTAAAGCCTTGGGGTTGG - Intronic
1029899162 7:104021870-104021892 TGGATTTGCAGCCATGGGTTGGG - Intergenic
1030085422 7:105811630-105811652 TGCATTTATAGCCATGGGGCTGG + Intronic
1030626790 7:111853679-111853701 TGGGATTAAAGCCAGTGGGTGGG - Intronic
1034464143 7:151215863-151215885 TGGAATTCCTGCCAGGGGGTGGG + Intronic
1034787501 7:153938306-153938328 TGGAAGTCCTGCCATTGGGTTGG + Intronic
1035202119 7:157274315-157274337 TGGGATTACAGACATGAGCTCGG - Intergenic
1035433976 7:158844082-158844104 GTGAATTACAGCCATCGGTTTGG + Intergenic
1037222093 8:16536388-16536410 TGAACTTCCAGCCTTGGGGTTGG - Intronic
1037740922 8:21608668-21608690 GGTAATAACATCCATGGGGTTGG + Intergenic
1038423725 8:27451363-27451385 AGAGATTACAGCCATGGGGTCGG - Intronic
1038587464 8:28802838-28802860 TGGGATTACAGGCATGAGCTAGG - Intronic
1039455522 8:37703391-37703413 TGTTATTACAGCCATTGGGGAGG - Intergenic
1041477684 8:58283769-58283791 TGGAATCACAGACTTAGGGTTGG - Intergenic
1042437184 8:68780648-68780670 TGGGATTACAGGCATGAGCTGGG - Intronic
1047428080 8:124765034-124765056 TGGAATTACAGGCATGAGCAAGG + Intergenic
1048036815 8:130684917-130684939 TGGGATTACAGGAATGAGGTGGG + Intergenic
1049232453 8:141491552-141491574 TGGCATGACTGCCATGGGATGGG + Intergenic
1049633519 8:143672886-143672908 TGGAATTACAGAAATGGGCCAGG - Intergenic
1050010678 9:1182833-1182855 TGGTATTACAACCATGAGGCTGG + Intergenic
1051273551 9:15377736-15377758 TGAAATTACAGCTATGTGTTTGG - Intergenic
1053126095 9:35581957-35581979 TGGGATTACAGCCATGTGTTGGG + Intergenic
1056245522 9:84691361-84691383 TATAATTACAGCCCTGGGATAGG - Intronic
1056765426 9:89441946-89441968 TGTAAACACAGCCATGGGGATGG - Intronic
1056817311 9:89811401-89811423 TGGAAGTACAGACATGGGGATGG + Intergenic
1057866695 9:98687218-98687240 GGGATTTACAGCCAAGGGGCAGG + Intronic
1059960511 9:119560006-119560028 TGTAATTTCAGCCACGGGGGAGG - Intergenic
1061404325 9:130385182-130385204 TGGGCTCACAGCCATGGGGAAGG + Intronic
1188281991 X:28281466-28281488 TGGGATTACAGGCATGAAGTAGG - Intergenic
1189289883 X:39877546-39877568 TGGGATTACAGACATGCAGTCGG + Intergenic
1189526238 X:41824931-41824953 AGGAATTATTGCCAAGGGGTTGG - Intronic
1189843060 X:45102814-45102836 TTGATTTTCAGCCATGTGGTTGG + Intronic
1192792359 X:74394990-74395012 TGTAATAATAGCCATGGGCTGGG - Intergenic
1196150104 X:112364215-112364237 TGTAATTACAGTCTTGGGCTAGG - Intergenic
1197150537 X:123215872-123215894 TGGAACTGCAGCCCTGGGTTAGG - Intronic