ID: 932256655

View in Genome Browser
Species Human (GRCh38)
Location 2:70293660-70293682
Sequence CCGCGGGCTCACAGATGCCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 1, 2: 3, 3: 8, 4: 107}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932256655 Original CRISPR CCGCGGGCTCACAGATGCCT TGG Exonic
900103743 1:973607-973629 CCGCAGGGTCACAGATGTCCGGG + Exonic
901940243 1:12656366-12656388 CCCAGGGGCCACAGATGCCTGGG - Intronic
903931133 1:26863167-26863189 CGGCGGGCTAACTGCTGCCTGGG - Exonic
904143460 1:28371226-28371248 CCAGAGGCTCCCAGATGCCTGGG + Intronic
906448367 1:45922673-45922695 CCGAGAGTTCAGAGATGCCTGGG + Intronic
908767925 1:67570885-67570907 CCCTGGGCCCACGGATGCCTGGG + Intergenic
922565960 1:226602026-226602048 CCGTGGGCTCACAGCTGCTGTGG - Exonic
923765820 1:236891479-236891501 CCTCGTCCTCACAGATGGCTTGG - Intronic
923918066 1:238530632-238530654 CCGAGAGCACAGAGATGCCTAGG + Intergenic
1063116155 10:3073408-3073430 CCGTGTGCCCAGAGATGCCTAGG + Intronic
1065881840 10:30043795-30043817 CCCCGGGCTGCCAGATGCCTTGG - Intronic
1070796916 10:79222283-79222305 CCGCGTCCTCACAGCTGACTGGG + Intronic
1077110247 11:859100-859122 CCCCGGGCTCACACGTGCCCTGG + Intronic
1083714898 11:64569570-64569592 TCCTGGGCTCACAGATGCCAGGG - Intronic
1084949120 11:72654967-72654989 CAGCAGGCACACAGGTGCCTGGG + Intronic
1089996717 11:122915257-122915279 CCGCGGGCTCATAGCAGTCTGGG - Intronic
1092232822 12:6786327-6786349 CAGCACCCTCACAGATGCCTTGG - Intergenic
1094224188 12:28026936-28026958 CTGAGGGCCCACAGATGACTCGG + Intergenic
1097068869 12:56340170-56340192 CTGTTGGCTCACAGGTGCCTGGG - Exonic
1098596088 12:72273712-72273734 CCGGGGTCTCCCAGATGCCTCGG + Intronic
1103863257 12:124030748-124030770 CCTCGGGCTGCAAGATGCCTGGG + Intronic
1104662566 12:130621600-130621622 CCGTGGGCTCAGAGAGGCCTTGG - Intronic
1104942065 12:132399822-132399844 CCGCGGGCTCCCGGACGCCTGGG + Intergenic
1114602792 14:23969838-23969860 CCGCGGGCTCTCAGGAGGCTCGG + Intergenic
1114607160 14:24006967-24006989 CCGCGGGCTCTCAGGAGGCTCGG + Intergenic
1116865995 14:50032103-50032125 GCACAGGCTCACAGAGGCCTAGG + Intergenic
1119180099 14:72599844-72599866 CTGTGGGCTCACACAGGCCTCGG + Intergenic
1119643811 14:76334450-76334472 CCTCGCGCTCACAGCCGCCTGGG + Intronic
1122609646 14:102973160-102973182 CAGCGGGCCCAGAGAGGCCTGGG - Intronic
1122788243 14:104173740-104173762 CCGCCGCCTCACAGCTGCCCAGG - Exonic
1123953642 15:25311212-25311234 CCACAGACCCACAGATGCCTGGG - Intergenic
1127585440 15:60373586-60373608 CAGCAGGCTGACAGATGCCAGGG + Intronic
1131828891 15:96341870-96341892 ACGCGGGCTCACACATTTCTAGG - Intergenic
1132588921 16:717949-717971 CTGCGGGCTCACAGCAGCCATGG - Exonic
1134119174 16:11571614-11571636 GGGCGGGCAGACAGATGCCTGGG - Intronic
1137767487 16:50989293-50989315 CGTGGGGCTCACAGATGCCAGGG - Intergenic
1142105884 16:88302523-88302545 CCCTGGGCTCACAGCTGCCTGGG + Intergenic
1143520154 17:7440164-7440186 CCGGGGGTTTCCAGATGCCTGGG + Intronic
1143562779 17:7705335-7705357 AGGCGGGCTCACAGATCCCGGGG + Exonic
1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG + Exonic
1145858881 17:28189614-28189636 CCAAGGGCTCAGAGAGGCCTGGG + Intronic
1147257807 17:39192542-39192564 CCTCAGGGTCACAGATGTCTGGG - Intronic
1148131400 17:45264525-45264547 CCGGGGGCTGGCAGATCCCTGGG + Exonic
1149766260 17:59281095-59281117 CTGTGGGCTCACAGATGCCTTGG - Intergenic
1150904113 17:69318700-69318722 CCACAGGTTCACAGATGCCTTGG - Intronic
1152605639 17:81288304-81288326 CCCCGGGCTCACAGCTCCCGCGG - Intronic
1152837634 17:82544450-82544472 CCGTGGGCCCAGAGATGCTTTGG + Intronic
1154367661 18:13726296-13726318 CCGCTGCCCCACAGAGGCCTGGG + Intronic
1155213618 18:23623083-23623105 GCACTGGCTCACAGATGCTTAGG + Intronic
1158154216 18:54407125-54407147 CCGCGGGCTCACGGATGCCTTGG + Intergenic
1160153493 18:76413049-76413071 CCGCTTCCTCACAGAGGCCTTGG - Intronic
1160225783 18:77009709-77009731 TCACGGCCTCACAGATGCCCCGG + Intronic
1160824453 19:1073169-1073191 CCGCGGGCCCACGAGTGCCTGGG + Exonic
1160984011 19:1829094-1829116 CCGCGGGCACACTGCTGGCTGGG - Intronic
1161280286 19:3442037-3442059 CCTGAGGCTCACAGAGGCCTGGG + Intronic
1161487399 19:4543577-4543599 CCGGGGGCCCCCCGATGCCTTGG - Exonic
1161512605 19:4679783-4679805 CCGCGAGCCGACAGATCCCTGGG - Intronic
1163022338 19:14489355-14489377 CCATGGGCTCACAGATGCCTTGG - Intronic
1163635738 19:18436545-18436567 TCTCGGACTCACAGAGGCCTGGG + Intronic
1168293985 19:55369960-55369982 CCGCGGGCTCCCTGGGGCCTGGG + Intronic
925731668 2:6923406-6923428 CCGCGGGCTCACAGGTAACTTGG - Intronic
927428831 2:23009294-23009316 CTGCTGGTTCAAAGATGCCTGGG + Intergenic
932256655 2:70293660-70293682 CCGCGGGCTCACAGATGCCTTGG + Exonic
935237570 2:101151372-101151394 CCGCGGGCTCTCAGAGCGCTGGG - Intronic
936054480 2:109251389-109251411 CCATGCACTCACAGATGCCTTGG - Intronic
937230954 2:120397823-120397845 TCCCGGGGTCACAGATGTCTCGG + Intergenic
947219458 2:227778746-227778768 CCACAGGCTCACAGATGCCTTGG + Intergenic
948463445 2:238141159-238141181 CCCCGAACTCACAGATGCCCAGG - Exonic
1175883221 20:62272338-62272360 GCGAGTCCTCACAGATGCCTGGG - Intronic
1175936218 20:62515317-62515339 CCTAGGGTTCACAGATGCCCAGG + Intergenic
1176250024 20:64116227-64116249 CCTCAGGCTCCCAGAAGCCTCGG - Intergenic
1179116983 21:38502381-38502403 CCTCAGGTTCACAGATGCTTTGG - Intronic
1180695938 22:17751672-17751694 CTGGGGGCTCACACAGGCCTGGG + Intronic
1183711027 22:39503215-39503237 CCGCGGGCCCACAGCTGTCAAGG - Intronic
1184457729 22:44621040-44621062 ACGCAGGCTCAGAGAGGCCTAGG + Intergenic
952950011 3:38515404-38515426 CAGCCAGCTCACAGATGCCCTGG + Intronic
954909048 3:54087870-54087892 CCGCAGGGTCCCAGATGGCTCGG - Intergenic
955817272 3:62858437-62858459 CAGCTGGCTCACAGGTGCCCAGG - Intronic
961302774 3:125932994-125933016 CCGCGGGCTCCCAGAGTTCTAGG + Intronic
966306930 3:178546913-178546935 CCGCCATCTCACAGCTGCCTGGG - Intronic
977551575 4:98448858-98448880 CCACAGGGTCACAGATGCATAGG - Intergenic
983593192 4:169437600-169437622 CCCGGGGCTCACAGATGCTAAGG - Intronic
987087837 5:14486826-14486848 ACGCTTGCTCACACATGCCTGGG + Intronic
988251311 5:28761265-28761287 TCGCTGGCTCACTCATGCCTTGG + Intergenic
990695480 5:58411874-58411896 CAGCGGGGTCAAAGAAGCCTAGG - Intergenic
997197778 5:131991087-131991109 ACGCGGGCACACAGATGCCACGG - Intronic
998797474 5:145835289-145835311 CCGCGAGCTCAGAGCTGCCCAGG + Exonic
998833434 5:146182659-146182681 CGGCGGGCTGTGAGATGCCTTGG - Exonic
1002081780 5:176741690-176741712 CCGGGGCCTCACAGAAGACTGGG + Intergenic
1009610301 6:65931619-65931641 CCAAGGGCACAGAGATGCCTTGG + Intergenic
1014137781 6:117908046-117908068 CCGCGGGCGCAGAGAGGCCGCGG + Intronic
1015538156 6:134287220-134287242 CCTCGGGCTCCCAGATAGCTGGG + Intronic
1019448802 7:1085412-1085434 CCGCGGCCTCACAGCTGGCCAGG - Intronic
1019524601 7:1475131-1475153 CCGCGGCCTCACAGAGTGCTGGG - Intronic
1019716885 7:2543255-2543277 GCGCGGGCTCTGAGCTGCCTGGG - Exonic
1023319360 7:38976301-38976323 CTGCGGGCTCACAGAGGGCAGGG - Intergenic
1024808467 7:53178452-53178474 ACGCGGGCTTCCAGATGCATTGG - Intergenic
1025015476 7:55435699-55435721 GCAGGGGCTCTCAGATGCCTGGG + Intergenic
1034823113 7:154235205-154235227 CAGAGTGATCACAGATGCCTGGG - Intronic
1035221032 7:157406667-157406689 CTGCGGGCTCAGAGAAGCCCTGG - Intronic
1035396800 7:158540217-158540239 CCGGGGGCTCCCAGGAGCCTCGG + Intronic
1036565214 8:9932668-9932690 CCCCTGGCTCTCTGATGCCTTGG - Intergenic
1039534879 8:38300713-38300735 CCCTGGTCTCACAGTTGCCTAGG - Intronic
1049145962 8:141001215-141001237 CCGCGGGCTCACAGTGGTCCGGG + Intronic
1053276471 9:36787236-36787258 CCACTGGCTCACAGCAGCCTGGG - Intergenic
1053372759 9:37576331-37576353 CCGGGGGCGGACAGCTGCCTGGG + Intronic
1053423977 9:37999016-37999038 CTGCGGGATCACAGAGCCCTGGG + Intronic
1053621648 9:39825481-39825503 CCTCTGACTCACAGATCCCTGGG + Intergenic
1053837582 9:42157343-42157365 CCTCTGACTCACAGATCCCTGGG + Intergenic
1053883447 9:42618816-42618838 CCTCTGACTCACAGATCCCTGGG - Intergenic
1053889222 9:42675483-42675505 CCTCTGACTCACAGATCCCTGGG + Intergenic
1054228243 9:62482889-62482911 CCTCTGACTCACAGATCCCTGGG + Intergenic
1056772753 9:89491851-89491873 CCCGGGGCCCACAGATGCATGGG - Intronic
1056828916 9:89898526-89898548 ACCCGTGGTCACAGATGCCTGGG - Intergenic
1060961604 9:127684704-127684726 CTGCTGGCTCACCCATGCCTTGG + Intronic
1061269405 9:129529008-129529030 CCTCGGCCTCACAGAGGGCTGGG - Intergenic
1186446818 X:9637012-9637034 TGGCTGGCTCACATATGCCTAGG + Intronic
1190699342 X:52975205-52975227 CCGTGGCCTCAAAGATGCCACGG + Intronic
1193576469 X:83203967-83203989 CTGCGGACTCACAGAGGCTTGGG - Intergenic
1196192740 X:112811488-112811510 CCCAGGGCTCACAGATGGCCAGG + Intronic