ID: 932257743

View in Genome Browser
Species Human (GRCh38)
Location 2:70301837-70301859
Sequence CAGTGCAAGGCGTCGCGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 63}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932257731_932257743 15 Left 932257731 2:70301799-70301821 CCAGGGCCGCCCACACCCGGTCT 0: 1
1: 0
2: 2
3: 9
4: 187
Right 932257743 2:70301837-70301859 CAGTGCAAGGCGTCGCGTGGTGG 0: 1
1: 0
2: 1
3: 3
4: 63
932257740_932257743 -1 Left 932257740 2:70301815-70301837 CCGGTCTGCGGGGACGCGGCTGC 0: 1
1: 0
2: 1
3: 7
4: 90
Right 932257743 2:70301837-70301859 CAGTGCAAGGCGTCGCGTGGTGG 0: 1
1: 0
2: 1
3: 3
4: 63
932257725_932257743 26 Left 932257725 2:70301788-70301810 CCCCGGCGACCCCAGGGCCGCCC 0: 1
1: 0
2: 3
3: 38
4: 343
Right 932257743 2:70301837-70301859 CAGTGCAAGGCGTCGCGTGGTGG 0: 1
1: 0
2: 1
3: 3
4: 63
932257730_932257743 16 Left 932257730 2:70301798-70301820 CCCAGGGCCGCCCACACCCGGTC 0: 1
1: 0
2: 1
3: 15
4: 185
Right 932257743 2:70301837-70301859 CAGTGCAAGGCGTCGCGTGGTGG 0: 1
1: 0
2: 1
3: 3
4: 63
932257729_932257743 17 Left 932257729 2:70301797-70301819 CCCCAGGGCCGCCCACACCCGGT 0: 1
1: 0
2: 0
3: 27
4: 177
Right 932257743 2:70301837-70301859 CAGTGCAAGGCGTCGCGTGGTGG 0: 1
1: 0
2: 1
3: 3
4: 63
932257734_932257743 9 Left 932257734 2:70301805-70301827 CCGCCCACACCCGGTCTGCGGGG 0: 1
1: 0
2: 0
3: 7
4: 145
Right 932257743 2:70301837-70301859 CAGTGCAAGGCGTCGCGTGGTGG 0: 1
1: 0
2: 1
3: 3
4: 63
932257736_932257743 6 Left 932257736 2:70301808-70301830 CCCACACCCGGTCTGCGGGGACG 0: 1
1: 0
2: 0
3: 6
4: 36
Right 932257743 2:70301837-70301859 CAGTGCAAGGCGTCGCGTGGTGG 0: 1
1: 0
2: 1
3: 3
4: 63
932257727_932257743 24 Left 932257727 2:70301790-70301812 CCGGCGACCCCAGGGCCGCCCAC 0: 1
1: 0
2: 4
3: 24
4: 290
Right 932257743 2:70301837-70301859 CAGTGCAAGGCGTCGCGTGGTGG 0: 1
1: 0
2: 1
3: 3
4: 63
932257726_932257743 25 Left 932257726 2:70301789-70301811 CCCGGCGACCCCAGGGCCGCCCA 0: 1
1: 0
2: 0
3: 23
4: 221
Right 932257743 2:70301837-70301859 CAGTGCAAGGCGTCGCGTGGTGG 0: 1
1: 0
2: 1
3: 3
4: 63
932257737_932257743 5 Left 932257737 2:70301809-70301831 CCACACCCGGTCTGCGGGGACGC 0: 1
1: 0
2: 0
3: 8
4: 83
Right 932257743 2:70301837-70301859 CAGTGCAAGGCGTCGCGTGGTGG 0: 1
1: 0
2: 1
3: 3
4: 63
932257724_932257743 29 Left 932257724 2:70301785-70301807 CCGCCCCGGCGACCCCAGGGCCG 0: 1
1: 0
2: 1
3: 17
4: 263
Right 932257743 2:70301837-70301859 CAGTGCAAGGCGTCGCGTGGTGG 0: 1
1: 0
2: 1
3: 3
4: 63
932257739_932257743 0 Left 932257739 2:70301814-70301836 CCCGGTCTGCGGGGACGCGGCTG 0: 1
1: 0
2: 1
3: 24
4: 223
Right 932257743 2:70301837-70301859 CAGTGCAAGGCGTCGCGTGGTGG 0: 1
1: 0
2: 1
3: 3
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932257743 Original CRISPR CAGTGCAAGGCGTCGCGTGG TGG Intronic
905124610 1:35708034-35708056 CTGTGCGGGGCGGCGCGTGGGGG + Intergenic
905581305 1:39084330-39084352 CAGGGCAAGGTGTCCCCTGGGGG - Exonic
910831921 1:91469954-91469976 CAGTGCAGGGCTTCACATGGTGG - Intergenic
918040413 1:180910979-180911001 CAGGGCAAGGCTGGGCGTGGTGG + Intergenic
920160434 1:203993807-203993829 CACTGCAAGGCTGGGCGTGGTGG + Intergenic
1073463833 10:103682211-103682233 CAGAGCAAGGCGGAGCGGGGAGG - Intronic
1075847508 10:125556565-125556587 CAGTGAAAGGAGGTGCGTGGGGG + Intergenic
1089384925 11:118061096-118061118 CAGTGCAAGGTGTCCCGTTTTGG - Intergenic
1089692918 11:120197880-120197902 CAGGGCAAGGCGGTGGGTGGGGG + Intergenic
1104286416 12:127428783-127428805 CTGTGCATGGCGTGGGGTGGGGG - Intergenic
1109694964 13:65942551-65942573 CAGTGCAAGGTCAAGCGTGGTGG - Intergenic
1111199975 13:84922629-84922651 CAGAGCAAGGCGGGGCGGGGGGG - Intergenic
1116781693 14:49243982-49244004 AAGTGCAAGGAGCCGGGTGGGGG + Intergenic
1117758855 14:59004924-59004946 GAGTACAAGGCCTGGCGTGGTGG - Intergenic
1117793157 14:59362165-59362187 CAGAGCAAGGCCTGGGGTGGAGG + Intronic
1120480030 14:85038026-85038048 CAGTGCAAGGAGGTGGGTGGGGG - Intergenic
1122779673 14:104138436-104138458 CAGTGCTGGGCGGCGCGTGGGGG - Intergenic
1124259678 15:28177483-28177505 CAGTTAAAGCCGTCGCGTGCCGG + Exonic
1125753160 15:42044363-42044385 CAGTGCAAGGCGTTGAGGAGTGG + Intronic
1126891030 15:53204295-53204317 CAGAGGAAGGTGTCGAGTGGGGG - Intergenic
1133301707 16:4786640-4786662 CAGTGCAAGGCCGGGTGTGGTGG - Intronic
1142811318 17:2396856-2396878 CCGGGCAAGGGGTGGCGTGGGGG + Intronic
1143453978 17:7053890-7053912 CACTGGGAGGAGTCGCGTGGGGG + Intergenic
1146115277 17:30131959-30131981 CAGTGCAAGGCCAGGCGCGGTGG + Intronic
1147193851 17:38752245-38752267 AAGGGGAAGGCGTCGCGTGTAGG - Intergenic
1149746979 17:59107973-59107995 CAGTGCTAGGCCTGGCGTGGTGG + Intergenic
1152128504 17:78461751-78461773 CAGTGCAGGGCGGCGTGTGTCGG - Intronic
1152900648 17:82939256-82939278 CAGTGGAAGGCGTCAGGAGGAGG - Intronic
1154004449 18:10514990-10515012 CTGTGCAAGGTGTGGGGTGGAGG + Intergenic
1158511516 18:58094728-58094750 CACTGCAAGGCATGGCATGGAGG + Intronic
1162834922 19:13310166-13310188 CAGTTTAAGGCGGGGCGTGGTGG + Intronic
1164658520 19:29942255-29942277 CCCAGCCAGGCGTCGCGTGGCGG - Exonic
1164776550 19:30857692-30857714 CAATGGAAGGCGGGGCGTGGTGG + Intergenic
1165347159 19:35255734-35255756 GAGTGCCAGGCGTGGAGTGGGGG - Intronic
1167287363 19:48606021-48606043 AAGTGCCAGGCGTGGTGTGGTGG + Intronic
1168480194 19:56713616-56713638 CACTGCAAGGCCGGGCGTGGTGG - Intergenic
925565410 2:5248566-5248588 CAATACAAGGCCTGGCGTGGTGG + Intergenic
932257743 2:70301837-70301859 CAGTGCAAGGCGTCGCGTGGTGG + Intronic
948357869 2:237394552-237394574 CAGGGCAGGGCGTAGCTTGGTGG + Intronic
949066447 2:241993613-241993635 CAGTGCGTGGCGTCGCGGTGCGG - Intergenic
1171815177 20:29779923-29779945 CAATGCAAGGCCAGGCGTGGTGG + Intergenic
1172468546 20:35174764-35174786 CAGGGCAACGCGTCGCTGGGGGG + Exonic
1174062116 20:47840107-47840129 CAGTGCAGGGCTCCGCGTTGGGG - Intergenic
1174503562 20:51002762-51002784 CAGTGCCAGGCGTGGGGAGGGGG - Intergenic
1175009753 20:55723355-55723377 CAGAGAAAGGAGTCGCATGGTGG - Intergenic
1183616916 22:38951100-38951122 AAGGGCAGGGCGTCACGTGGGGG + Intergenic
1184112111 22:42401535-42401557 CGGGGCAAGGGGTCCCGTGGAGG + Intronic
1184684093 22:46088195-46088217 CAGTTCAAGGCTTCCCCTGGGGG + Intronic
1184690118 22:46113666-46113688 CAGTGCAAGGCCGGGCCTGGCGG + Intronic
953023592 3:39131692-39131714 CAGTGCAGGGCATCACATGGTGG + Intronic
964373971 3:156031401-156031423 CAGTGGAAGGAGTGGGGTGGAGG + Intergenic
969670961 4:8590147-8590169 CAGTGCAGGGCCTAGCCTGGAGG - Intronic
970885614 4:20984622-20984644 CAGAACAAGGAGTGGCGTGGCGG - Intronic
973123680 4:46556973-46556995 CAGTGAAAGGCTTAGGGTGGAGG - Intergenic
984716491 4:182930398-182930420 CAGTGCAAGGCTGGGCGTGGTGG - Intergenic
985022070 4:185702211-185702233 CAGTGCCATGCGTCCCGTGCAGG - Intronic
987315160 5:16717122-16717144 CAGTTTAAGGCCGCGCGTGGTGG - Intronic
992869298 5:80990425-80990447 CAGTGAAAGGAGTCGGGAGGGGG + Intronic
993551560 5:89279784-89279806 CACTGCAAGGGGTGGGGTGGGGG + Intergenic
995156411 5:108918772-108918794 CAGTCCAAGGCGGGGCGCGGTGG - Intronic
1003314952 6:5003791-5003813 GAGTGCTAGGCTTCGCGGGGCGG - Intronic
1005649464 6:27873391-27873413 CCGTGCCAGGCGTCGGATGGCGG + Exonic
1006719809 6:36142860-36142882 CAGTGCAAGGTGGGGGGTGGAGG + Intronic
1007151839 6:39701269-39701291 CAGAGCAGGGCTTCCCGTGGGGG - Intronic
1035098040 7:156372525-156372547 CAGTGGAAGGCATCGCGTGGTGG + Intergenic
1035522805 8:288807-288829 CAGTGCCAGGCATCGCAGGGTGG - Intergenic
1058888001 9:109337437-109337459 CTGTGCATGGCCTGGCGTGGTGG - Intergenic
1195078874 X:101352475-101352497 GTGTGCAAGGCCTGGCGTGGTGG + Intronic