ID: 932260572

View in Genome Browser
Species Human (GRCh38)
Location 2:70323474-70323496
Sequence CAGGGTCTCTTAATGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932260564_932260572 24 Left 932260564 2:70323427-70323449 CCTGATTGGCTCAACCTCACATG No data
Right 932260572 2:70323474-70323496 CAGGGTCTCTTAATGGAGAAGGG No data
932260565_932260572 10 Left 932260565 2:70323441-70323463 CCTCACATGTGTGTACTTCTGAG No data
Right 932260572 2:70323474-70323496 CAGGGTCTCTTAATGGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932260572 Original CRISPR CAGGGTCTCTTAATGGAGAA GGG Intergenic
No off target data available for this crispr