ID: 932260572 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:70323474-70323496 |
Sequence | CAGGGTCTCTTAATGGAGAA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
932260564_932260572 | 24 | Left | 932260564 | 2:70323427-70323449 | CCTGATTGGCTCAACCTCACATG | No data | ||
Right | 932260572 | 2:70323474-70323496 | CAGGGTCTCTTAATGGAGAAGGG | No data | ||||
932260565_932260572 | 10 | Left | 932260565 | 2:70323441-70323463 | CCTCACATGTGTGTACTTCTGAG | No data | ||
Right | 932260572 | 2:70323474-70323496 | CAGGGTCTCTTAATGGAGAAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
932260572 | Original CRISPR | CAGGGTCTCTTAATGGAGAA GGG | Intergenic | ||
No off target data available for this crispr |