ID: 932262269

View in Genome Browser
Species Human (GRCh38)
Location 2:70336874-70336896
Sequence CAAAGCCCACAGGTTGGCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932262269_932262280 20 Left 932262269 2:70336874-70336896 CCAATGCCAACCTGTGGGCTTTG No data
Right 932262280 2:70336917-70336939 TAGGCAAGTCCCTTGGGCACAGG No data
932262269_932262278 13 Left 932262269 2:70336874-70336896 CCAATGCCAACCTGTGGGCTTTG No data
Right 932262278 2:70336910-70336932 GAGGGCTTAGGCAAGTCCCTTGG No data
932262269_932262281 21 Left 932262269 2:70336874-70336896 CCAATGCCAACCTGTGGGCTTTG No data
Right 932262281 2:70336918-70336940 AGGCAAGTCCCTTGGGCACAGGG No data
932262269_932262276 -5 Left 932262269 2:70336874-70336896 CCAATGCCAACCTGTGGGCTTTG No data
Right 932262276 2:70336892-70336914 CTTTGCTGGTGGGTGAGTGAGGG No data
932262269_932262279 14 Left 932262269 2:70336874-70336896 CCAATGCCAACCTGTGGGCTTTG No data
Right 932262279 2:70336911-70336933 AGGGCTTAGGCAAGTCCCTTGGG No data
932262269_932262277 1 Left 932262269 2:70336874-70336896 CCAATGCCAACCTGTGGGCTTTG No data
Right 932262277 2:70336898-70336920 TGGTGGGTGAGTGAGGGCTTAGG No data
932262269_932262275 -6 Left 932262269 2:70336874-70336896 CCAATGCCAACCTGTGGGCTTTG No data
Right 932262275 2:70336891-70336913 GCTTTGCTGGTGGGTGAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932262269 Original CRISPR CAAAGCCCACAGGTTGGCAT TGG (reversed) Intergenic
No off target data available for this crispr