ID: 932262276

View in Genome Browser
Species Human (GRCh38)
Location 2:70336892-70336914
Sequence CTTTGCTGGTGGGTGAGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932262269_932262276 -5 Left 932262269 2:70336874-70336896 CCAATGCCAACCTGTGGGCTTTG No data
Right 932262276 2:70336892-70336914 CTTTGCTGGTGGGTGAGTGAGGG No data
932262264_932262276 28 Left 932262264 2:70336841-70336863 CCTTCTAATCCACAATTGGAATC No data
Right 932262276 2:70336892-70336914 CTTTGCTGGTGGGTGAGTGAGGG No data
932262265_932262276 19 Left 932262265 2:70336850-70336872 CCACAATTGGAATCTGACAACCA No data
Right 932262276 2:70336892-70336914 CTTTGCTGGTGGGTGAGTGAGGG No data
932262268_932262276 -1 Left 932262268 2:70336870-70336892 CCAACCAATGCCAACCTGTGGGC No data
Right 932262276 2:70336892-70336914 CTTTGCTGGTGGGTGAGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932262276 Original CRISPR CTTTGCTGGTGGGTGAGTGA GGG Intergenic
No off target data available for this crispr