ID: 932262277

View in Genome Browser
Species Human (GRCh38)
Location 2:70336898-70336920
Sequence TGGTGGGTGAGTGAGGGCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932262269_932262277 1 Left 932262269 2:70336874-70336896 CCAATGCCAACCTGTGGGCTTTG No data
Right 932262277 2:70336898-70336920 TGGTGGGTGAGTGAGGGCTTAGG No data
932262271_932262277 -5 Left 932262271 2:70336880-70336902 CCAACCTGTGGGCTTTGCTGGTG No data
Right 932262277 2:70336898-70336920 TGGTGGGTGAGTGAGGGCTTAGG No data
932262274_932262277 -9 Left 932262274 2:70336884-70336906 CCTGTGGGCTTTGCTGGTGGGTG No data
Right 932262277 2:70336898-70336920 TGGTGGGTGAGTGAGGGCTTAGG No data
932262265_932262277 25 Left 932262265 2:70336850-70336872 CCACAATTGGAATCTGACAACCA No data
Right 932262277 2:70336898-70336920 TGGTGGGTGAGTGAGGGCTTAGG No data
932262268_932262277 5 Left 932262268 2:70336870-70336892 CCAACCAATGCCAACCTGTGGGC No data
Right 932262277 2:70336898-70336920 TGGTGGGTGAGTGAGGGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932262277 Original CRISPR TGGTGGGTGAGTGAGGGCTT AGG Intergenic
No off target data available for this crispr