ID: 932263269

View in Genome Browser
Species Human (GRCh38)
Location 2:70344670-70344692
Sequence ATGGAGAAATAGTGGGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932263257_932263269 22 Left 932263257 2:70344625-70344647 CCCTAACATTTCTGTGGGTTCTT No data
Right 932263269 2:70344670-70344692 ATGGAGAAATAGTGGGAGAGAGG No data
932263258_932263269 21 Left 932263258 2:70344626-70344648 CCTAACATTTCTGTGGGTTCTTA No data
Right 932263269 2:70344670-70344692 ATGGAGAAATAGTGGGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932263269 Original CRISPR ATGGAGAAATAGTGGGAGAG AGG Intergenic
No off target data available for this crispr