ID: 932266385

View in Genome Browser
Species Human (GRCh38)
Location 2:70370753-70370775
Sequence CCTCATCTGTAGAGTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932266375_932266385 23 Left 932266375 2:70370707-70370729 CCATCTGAGAGGCAGTAAGTCAC No data
Right 932266385 2:70370753-70370775 CCTCATCTGTAGAGTGAGGATGG No data
932266379_932266385 -4 Left 932266379 2:70370734-70370756 CCTCACAGGGCCCACAGGCCCTC No data
Right 932266385 2:70370753-70370775 CCTCATCTGTAGAGTGAGGATGG No data
932266374_932266385 24 Left 932266374 2:70370706-70370728 CCCATCTGAGAGGCAGTAAGTCA No data
Right 932266385 2:70370753-70370775 CCTCATCTGTAGAGTGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932266385 Original CRISPR CCTCATCTGTAGAGTGAGGA TGG Intergenic
No off target data available for this crispr