ID: 932268743

View in Genome Browser
Species Human (GRCh38)
Location 2:70390506-70390528
Sequence GACCTGGCTTACCCCACCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932268739_932268743 2 Left 932268739 2:70390481-70390503 CCCTGGGCAGCAGACTAGGGCTG No data
Right 932268743 2:70390506-70390528 GACCTGGCTTACCCCACCCCAGG No data
932268738_932268743 3 Left 932268738 2:70390480-70390502 CCCCTGGGCAGCAGACTAGGGCT No data
Right 932268743 2:70390506-70390528 GACCTGGCTTACCCCACCCCAGG No data
932268735_932268743 10 Left 932268735 2:70390473-70390495 CCTCTGACCCCTGGGCAGCAGAC No data
Right 932268743 2:70390506-70390528 GACCTGGCTTACCCCACCCCAGG No data
932268740_932268743 1 Left 932268740 2:70390482-70390504 CCTGGGCAGCAGACTAGGGCTGG No data
Right 932268743 2:70390506-70390528 GACCTGGCTTACCCCACCCCAGG No data
932268732_932268743 21 Left 932268732 2:70390462-70390484 CCAGGCAATAACCTCTGACCCCT No data
Right 932268743 2:70390506-70390528 GACCTGGCTTACCCCACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932268743 Original CRISPR GACCTGGCTTACCCCACCCC AGG Intergenic
No off target data available for this crispr