ID: 932269592

View in Genome Browser
Species Human (GRCh38)
Location 2:70398089-70398111
Sequence TTTTTTTGAAACGGCTCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932269592_932269599 10 Left 932269592 2:70398089-70398111 CCCACTGAGCCGTTTCAAAAAAA No data
Right 932269599 2:70398122-70398144 AGAATAGCCAGGGGAACTTTTGG No data
932269592_932269600 11 Left 932269592 2:70398089-70398111 CCCACTGAGCCGTTTCAAAAAAA No data
Right 932269600 2:70398123-70398145 GAATAGCCAGGGGAACTTTTGGG No data
932269592_932269596 0 Left 932269592 2:70398089-70398111 CCCACTGAGCCGTTTCAAAAAAA No data
Right 932269596 2:70398112-70398134 TCCATTTTGAAGAATAGCCAGGG No data
932269592_932269598 1 Left 932269592 2:70398089-70398111 CCCACTGAGCCGTTTCAAAAAAA No data
Right 932269598 2:70398113-70398135 CCATTTTGAAGAATAGCCAGGGG No data
932269592_932269601 14 Left 932269592 2:70398089-70398111 CCCACTGAGCCGTTTCAAAAAAA No data
Right 932269601 2:70398126-70398148 TAGCCAGGGGAACTTTTGGGAGG No data
932269592_932269595 -1 Left 932269592 2:70398089-70398111 CCCACTGAGCCGTTTCAAAAAAA No data
Right 932269595 2:70398111-70398133 ATCCATTTTGAAGAATAGCCAGG No data
932269592_932269603 26 Left 932269592 2:70398089-70398111 CCCACTGAGCCGTTTCAAAAAAA No data
Right 932269603 2:70398138-70398160 CTTTTGGGAGGCTTAACAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932269592 Original CRISPR TTTTTTTGAAACGGCTCAGT GGG (reversed) Intergenic
No off target data available for this crispr