ID: 932270022

View in Genome Browser
Species Human (GRCh38)
Location 2:70401121-70401143
Sequence CACCCTATGGAACTGGACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932270022_932270026 1 Left 932270022 2:70401121-70401143 CCCATGTCCAGTTCCATAGGGTG No data
Right 932270026 2:70401145-70401167 ATCATGAACTGTTTAAATCAAGG No data
932270022_932270027 21 Left 932270022 2:70401121-70401143 CCCATGTCCAGTTCCATAGGGTG No data
Right 932270027 2:70401165-70401187 AGGACTAGATACATAAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932270022 Original CRISPR CACCCTATGGAACTGGACAT GGG (reversed) Intergenic
No off target data available for this crispr