ID: 932274680

View in Genome Browser
Species Human (GRCh38)
Location 2:70443069-70443091
Sequence GGAGGTAAGGGGATTGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932274667_932274680 22 Left 932274667 2:70443024-70443046 CCTGTGTGGGGGCCATCCTTAGG No data
Right 932274680 2:70443069-70443091 GGAGGTAAGGGGATTGAGCAGGG No data
932274670_932274680 10 Left 932274670 2:70443036-70443058 CCATCCTTAGGATGGCTCTGATG No data
Right 932274680 2:70443069-70443091 GGAGGTAAGGGGATTGAGCAGGG No data
932274666_932274680 23 Left 932274666 2:70443023-70443045 CCCTGTGTGGGGGCCATCCTTAG No data
Right 932274680 2:70443069-70443091 GGAGGTAAGGGGATTGAGCAGGG No data
932274671_932274680 6 Left 932274671 2:70443040-70443062 CCTTAGGATGGCTCTGATGTTAG No data
Right 932274680 2:70443069-70443091 GGAGGTAAGGGGATTGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932274680 Original CRISPR GGAGGTAAGGGGATTGAGCA GGG Intergenic
No off target data available for this crispr