ID: 932279940

View in Genome Browser
Species Human (GRCh38)
Location 2:70481814-70481836
Sequence ACTTACAAGCTATTGTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 97}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932279940 Original CRISPR ACTTACAAGCTATTGTTGGG AGG (reversed) Intronic
901811742 1:11771345-11771367 ATTTAAAAGCTATTGCTGGGGGG - Intronic
907870830 1:58441278-58441300 ACTTACTAGCTGTTGGTCGGAGG - Intronic
909047723 1:70730148-70730170 ACTTATCAGCTATTCATGGGGGG - Intergenic
914446632 1:147756469-147756491 ACTTGGATGCTATTGTTGGGTGG - Exonic
914880330 1:151541449-151541471 ATTTCCAAGCTATTGTGGGTGGG + Intronic
915334888 1:155135504-155135526 ACTAGCAAGCTTTTGTTTGGAGG + Intronic
916906238 1:169287457-169287479 ACTTACAAGATATTTCTGTGGGG + Intronic
921475818 1:215607776-215607798 ACCTACAAGCTATTTTTATGAGG + Intronic
1066398796 10:35053831-35053853 ACTTACAAGCTTTTGTGTGCAGG + Intronic
1067198554 10:44145378-44145400 ACTTAAAAGCTTTTGTGAGGAGG - Intergenic
1072882040 10:99237085-99237107 ATTTGCAAGCTGTTGTGGGGTGG - Intergenic
1081470347 11:43364351-43364373 ACTTACAAGCTATTAATGGCTGG - Intronic
1086804702 11:91225959-91225981 ACTTTTAAACTGTTGTTGGGTGG + Intergenic
1092175887 12:6406561-6406583 ACTTACATGCTATTGCTAGCAGG - Intergenic
1092790812 12:12069391-12069413 ACTTGCAACCTTTTTTTGGGGGG - Intronic
1093312822 12:17611411-17611433 AATTACATGTTATTGTTGGTGGG - Intergenic
1097158987 12:57032367-57032389 ACTTACATTCTACTGTAGGGTGG + Intronic
1098276447 12:68816651-68816673 ACTTAGAAGCTACTTTTGGCTGG - Intronic
1099956007 12:89353323-89353345 AGTTACAAGCCATTGTTCGGGGG + Intergenic
1100269988 12:93015390-93015412 AATCACTAGCTATTGTTAGGTGG + Intergenic
1106577897 13:30992891-30992913 ACATAGAATATATTGTTGGGAGG + Intergenic
1106916254 13:34518411-34518433 ATTTATAAGCATTTGTTGGGGGG - Intergenic
1108193909 13:47972370-47972392 ACTAACAAATTATTGTTGGCTGG + Intronic
1114209767 14:20604853-20604875 ACTTACAAGTAATTGATGAGGGG + Intronic
1114785085 14:25587349-25587371 CCATACATGCTATTGTTGGAAGG + Intergenic
1128072780 15:64807824-64807846 AGTTACAAGCTAGGGCTGGGAGG - Intergenic
1128821896 15:70664140-70664162 ATTTAGAAGCTAATGTTGGAAGG - Intronic
1132411284 15:101579905-101579927 ACTTATAAGCTATTGTGAGTTGG - Intergenic
1136050555 16:27647010-27647032 ACTCACAAGCTGTGGGTGGGAGG - Intronic
1137837533 16:51607421-51607443 ACTGACAAGGTATTGTGTGGAGG + Intergenic
1139025927 16:62817755-62817777 ACTTAAAAGCTTTTGTGAGGAGG - Intergenic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1144379926 17:14684700-14684722 ACTTACATACTGTTGGTGGGAGG - Intergenic
1147539614 17:41346340-41346362 AATTTCAAGCTTTTGTTTGGAGG - Intronic
1149648213 17:58255747-58255769 ACTTACATGCTAATGTAAGGAGG - Intronic
1155060132 18:22221065-22221087 ACTTACACACTGTTGGTGGGAGG - Intergenic
1155227102 18:23738265-23738287 ACTTGCAAGCTGATGATGGGTGG + Intronic
928659160 2:33483292-33483314 GCTTAGAACCTATTGTGGGGTGG - Intronic
930179030 2:48333516-48333538 ACTTACAAGTATTTGTTGGGGGG + Intronic
930190042 2:48448313-48448335 ACTTTCAAGCTATTGCTGTTAGG - Intronic
931653744 2:64491282-64491304 ACTTACATTCTAGTGGTGGGGGG + Intergenic
931867507 2:66427692-66427714 ATTTTCAAGCTATTGTTATGAGG + Intergenic
932279940 2:70481814-70481836 ACTTACAAGCTATTGTTGGGAGG - Intronic
934592212 2:95564789-95564811 ACTTAGAAGCTGATTTTGGGTGG - Intergenic
938741262 2:134234674-134234696 AGTCACAAGCTTGTGTTGGGTGG + Intronic
946190367 2:218004603-218004625 ACTAACCATCTATTGTTTGGTGG + Intergenic
947076687 2:226352528-226352550 AATTACAAGGTATGGGTGGGGGG + Intergenic
947203606 2:227639712-227639734 ACTAACAAGCTAATGAAGGGAGG - Intergenic
947770889 2:232669172-232669194 ACCTCCAACCTATTCTTGGGGGG + Intronic
1171313188 20:24162571-24162593 ACTTAGAGACCATTGTTGGGTGG - Intergenic
1172943638 20:38671802-38671824 ACAAACAAGCCATTGTTGGCAGG - Intergenic
1174447346 20:50599093-50599115 ATTTAATAGCTATTGTTGGCTGG + Intronic
1175375743 20:58522764-58522786 ACTTGCAAGCTGATGGTGGGGGG - Intergenic
1175486377 20:59349778-59349800 ACTCACATGCTATTGCTGAGTGG + Intergenic
1177507417 21:22036659-22036681 ACTTATACACTGTTGTTGGGAGG - Intergenic
960598141 3:119426091-119426113 ACTTCCAAGCTCTTTTTGGAGGG - Intergenic
960616835 3:119603601-119603623 ACTTACATGCAAATGTTGGTGGG - Intronic
961901524 3:130217580-130217602 ACTTACAATTTATTTTAGGGTGG - Intergenic
966559298 3:181301673-181301695 ACTTACAAACTATTGGGGGTTGG + Intergenic
967310877 3:188104955-188104977 AGTTACAAGGGATTGTGGGGAGG - Intergenic
970633649 4:17982389-17982411 ACTTACACACTGTTGGTGGGAGG - Intronic
970654108 4:18212616-18212638 GGTTAAAAGCCATTGTTGGGGGG + Intergenic
976930133 4:90556518-90556540 ACTTACAGCCTATTGTTGACTGG + Intronic
979476952 4:121169487-121169509 GTTTACAAGCTAGTGTCGGGAGG - Intronic
981279745 4:142944091-142944113 ACTCAGAAGCTACTGATGGGAGG - Intergenic
981451722 4:144905990-144906012 ACATGGGAGCTATTGTTGGGAGG + Intergenic
983311887 4:166075360-166075382 ATATACAAGATATTTTTGGGAGG - Intronic
983861778 4:172716219-172716241 ACTAGCTAGCTATTGTTGTGTGG - Intronic
987954439 5:24719740-24719762 ACTTCCAAGCTAATCTTAGGAGG - Intergenic
987972372 5:24964994-24965016 ACATACCAGGTCTTGTTGGGTGG - Intergenic
993271287 5:85800362-85800384 ACTTAAAGGCTTTTGTTTGGTGG + Intergenic
994659224 5:102633572-102633594 ACTTAGGAGCTTTTTTTGGGGGG - Intergenic
995627145 5:114092131-114092153 ACTTACAAGATATAATTGAGCGG + Intergenic
999555520 5:152738420-152738442 ACTGACAAATTATTGTTGTGGGG - Intergenic
999920771 5:156318394-156318416 ACTTACAAGACTTTGTGGGGAGG - Intronic
1001637257 5:173219896-173219918 ACTTAGAAGTTATTGTTGTCTGG + Intergenic
1001842864 5:174894139-174894161 AATTAGAAGCTATTCATGGGTGG - Intergenic
1002892440 6:1347234-1347256 ATTTACAAGCTAGGGGTGGGGGG - Intergenic
1004276410 6:14240175-14240197 ACTTAAAAGCTAGTGTCGGATGG + Intergenic
1005927763 6:30458031-30458053 ACTCACAACCTATTGATAGGAGG + Intergenic
1007760658 6:44131737-44131759 ACTTATAAGCTTTTTTTTGGGGG - Intronic
1015101942 6:129491792-129491814 CCTTAAAAGCTATGGTTGAGAGG + Intronic
1015207276 6:130654355-130654377 AGATACAAGCTAATTTTGGGAGG + Intergenic
1016043887 6:139461336-139461358 GCTTTTAATCTATTGTTGGGGGG - Intergenic
1020856056 7:13425285-13425307 ACTTACGAGTTATTCTTGGTAGG - Intergenic
1021487603 7:21184096-21184118 ATTTACATGGTATTGTTGGCTGG + Intergenic
1023103390 7:36740948-36740970 ATTTAAAGGCTATTGTTTGGTGG + Intergenic
1023886721 7:44362455-44362477 ACTTCCAAGCAAGTGTTTGGAGG - Intergenic
1026152112 7:67796671-67796693 ACTTACAGGCTGATCTTGGGTGG + Intergenic
1027541486 7:79472223-79472245 ACTTATAAGCAATGCTTGGGAGG + Intergenic
1030231956 7:107217377-107217399 ACTTCCAAGCTAGTTTTAGGAGG + Intronic
1031793348 7:126138575-126138597 ACTGACAAGGCATTGTTGGCAGG - Intergenic
1033567839 7:142597079-142597101 ACTGACAATCTATAGTTAGGAGG - Intergenic
1034466188 7:151230975-151230997 ACATACAAGATATTCTTGAGTGG + Intergenic
1037632275 8:20668994-20669016 ACATACAAGCAATAGTTTGGAGG - Intergenic
1038369573 8:26974676-26974698 ACTTAAAAGCCATACTTGGGAGG + Intergenic
1042193492 8:66211862-66211884 GATTACAAGTTGTTGTTGGGAGG - Intergenic
1042623376 8:70730646-70730668 ACTCAGAAGCGATTGTTGAGGGG + Intronic
1047312331 8:123703036-123703058 ATTCACATGCAATTGTTGGGTGG - Intronic
1050969514 9:11851924-11851946 AATTACAAGATATTTTTGAGAGG - Intergenic
1053385930 9:37688553-37688575 ACTTCCCAGATATTTTTGGGGGG - Intronic
1189552511 X:42107816-42107838 ACTTACATTCTGGTGTTGGGAGG + Intergenic
1194561354 X:95425768-95425790 AATTAAAAGCTTTTGTTGAGAGG + Intergenic