ID: 932280203

View in Genome Browser
Species Human (GRCh38)
Location 2:70484832-70484854
Sequence TTGAACAAAAGCAACTTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 260}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932280203_932280206 28 Left 932280203 2:70484832-70484854 CCAACAAAGTTGCTTTTGTTCAA 0: 1
1: 0
2: 3
3: 16
4: 260
Right 932280206 2:70484883-70484905 AGAACCCTAGTTGATGTATTCGG 0: 1
1: 0
2: 1
3: 7
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932280203 Original CRISPR TTGAACAAAAGCAACTTTGT TGG (reversed) Intronic
908150250 1:61293371-61293393 TTAAACAAAAGGAACATTATGGG + Intronic
911937781 1:104002303-104002325 TTGATCTAAAGCAAATATGTAGG + Intergenic
912385406 1:109268897-109268919 TTGGACAAAGGGAACTTTGCTGG + Exonic
917896593 1:179495145-179495167 TTGAAAAAAAACAAATTTGGAGG - Intronic
918673576 1:187253013-187253035 TTGAACAACATCACCTTTCTGGG - Intergenic
918971813 1:191429565-191429587 TTGAACGAAAGCAACAATATTGG + Intergenic
919139628 1:193554667-193554689 TTGGACAAAAGCACTTTTATGGG + Intergenic
919529962 1:198704938-198704960 TGGAATAACAGCAAGTTTGTTGG + Intronic
921400576 1:214718621-214718643 TTGACAAAAAGGAACCTTGTAGG - Intergenic
922897687 1:229113203-229113225 TTGAACAATATCACCTTTGTGGG - Intergenic
923350823 1:233104079-233104101 TTGAACAAAATGAAATTTTTTGG - Intronic
1063070209 10:2654026-2654048 GAGGACAAAGGCAACTTTGTAGG + Intergenic
1064972524 10:21080734-21080756 TTGAGTAAATGCAACTTTGATGG + Intronic
1068161141 10:53265940-53265962 TTAACCAAAATCAACATTGTTGG + Intergenic
1068431857 10:56943354-56943376 TTGTACATAAGCATCTTTTTCGG - Intergenic
1069257305 10:66349140-66349162 CAGAAGACAAGCAACTTTGTTGG + Intronic
1070012517 10:72490538-72490560 TGGAACAAAGGGAACTTCGTGGG - Intronic
1072059983 10:91800073-91800095 TTGATCAATTGCACCTTTGTTGG + Intronic
1073589401 10:104742247-104742269 ATGAACAAAAACAATTTTCTGGG - Intronic
1073721084 10:106172576-106172598 TTCAAGAAAAGAGACTTTGTTGG - Intergenic
1074269667 10:111941567-111941589 TTGAACAAAAGGATGTATGTAGG - Intergenic
1075342123 10:121655516-121655538 TTGAACAAACACATCTCTGTGGG - Intergenic
1075358705 10:121809611-121809633 TTATACAAAAGCAACTGTGATGG - Intronic
1076243407 10:128927607-128927629 TTGAACAAAGGCCAATTTTTCGG + Intergenic
1077626170 11:3773748-3773770 TTAAATAAAGGCAAATTTGTAGG + Intronic
1078963062 11:16302194-16302216 TTTAAGAAAAGTAACTTTGGTGG - Intronic
1079518471 11:21296207-21296229 TTGAACACAAGAAACTATTTTGG + Intronic
1079573178 11:21969970-21969992 TTGAACAACTGCAAATTTCTGGG + Intergenic
1079671255 11:23174335-23174357 GTGAACAACAGGATCTTTGTTGG - Intergenic
1080844394 11:36014234-36014256 TTGAACAGAAGCTGTTTTGTGGG + Intronic
1081022352 11:37961842-37961864 TTGAAAAAAAGCATCTTTTGGGG + Intergenic
1082717662 11:56634738-56634760 TTGAACAAAAGCAATTTCCAGGG - Intergenic
1083191645 11:61056598-61056620 ATGAAGAAAAGCACCTTTGGGGG - Intergenic
1085684780 11:78611686-78611708 ATGAACAAAAGTAACCATGTTGG + Intergenic
1088675223 11:112186286-112186308 TTGAAGATAAGCATCTTTGTGGG + Intronic
1089865939 11:121631776-121631798 TTGAAAAAAAGCAGCCTTTTAGG + Exonic
1093269717 12:17045015-17045037 TTGAACAAAATATACCTTGTTGG - Intergenic
1096192029 12:49625702-49625724 TGGAACAAAAACACATTTGTGGG - Intronic
1096506003 12:52093813-52093835 TTCAACAAAAGCAACCCTTTTGG + Intergenic
1097418569 12:59345461-59345483 TTCAAGAAAGGCAATTTTGTAGG + Intergenic
1097812401 12:64033235-64033257 TTGAACAAAAGACACTGTCTGGG - Intronic
1097848367 12:64388854-64388876 TTGAACTAAAACAATTTTTTTGG - Intronic
1098135060 12:67393548-67393570 TTGATAAAAAGCAATTTTCTGGG + Intergenic
1099155776 12:79174142-79174164 TTTAACAAAAGGAATTTTGAGGG + Intronic
1099579759 12:84429423-84429445 TTCAAAAAAAGCAACATTTTTGG - Intergenic
1100351406 12:93787044-93787066 TTGAGCAATAGCAACATTATTGG - Intronic
1101414652 12:104498595-104498617 TTCAATAAAAGCATCTTTGAAGG - Intronic
1101417344 12:104519876-104519898 TTCAACAAAACCAACTGTGAAGG - Intronic
1102174210 12:110864319-110864341 TTGACCACAGGCAACTGTGTAGG - Intronic
1102946011 12:116988814-116988836 TACACCAAAAGCAACTTGGTTGG - Exonic
1104104218 12:125643923-125643945 TTGTACAAAAGGTAATTTGTAGG - Intronic
1104275820 12:127326585-127326607 TTGTACAAAAGGTAATTTGTAGG + Intergenic
1107540336 13:41383785-41383807 TAGAACAAAACCAAGTGTGTGGG + Intergenic
1108395058 13:49983858-49983880 TTGAAATCAAGCAACTTTCTTGG + Intergenic
1109485817 13:63017510-63017532 TTCAACAAAAGTAACTTCATAGG + Intergenic
1110011791 13:70345124-70345146 CTCAAAGAAAGCAACTTTGTTGG - Intergenic
1110299541 13:73909709-73909731 TTAAACAAACGTAAGTTTGTTGG - Intronic
1111063674 13:83060383-83060405 TTGAAAACAAGGAATTTTGTTGG - Intergenic
1112168207 13:96942690-96942712 CTGAACAAAAGCAACAATGGGGG - Intergenic
1112484009 13:99803306-99803328 TAGAACAAAGGCAACATTGTGGG + Intronic
1113299972 13:109007433-109007455 TTCTACAAAAGCAAGTTTGATGG + Intronic
1113446356 13:110370951-110370973 GTTAACAAAAAGAACTTTGTGGG + Intronic
1114422478 14:22596468-22596490 TTGAACGAAGCCAAGTTTGTTGG + Intergenic
1114560082 14:23583431-23583453 TTTAACAAATGCAATTTTGGGGG + Intergenic
1114884505 14:26831714-26831736 TTCACCAAAAGCACCTTTCTTGG - Intergenic
1114941826 14:27622667-27622689 TTAAACATGAGCAACTTTGAGGG + Intergenic
1115005754 14:28482330-28482352 ATGAACAAGAGCCAGTTTGTTGG - Intergenic
1115275189 14:31600577-31600599 TTGAAAGAAAGCAATTTTATTGG + Intronic
1115484809 14:33900631-33900653 TAGAACAAAAGTAACTCTGGAGG + Intergenic
1116090112 14:40293972-40293994 TGGACCAAAGGCAACTTTTTGGG + Intergenic
1117555184 14:56876681-56876703 TTGAACCTAAGCAACCTTGCTGG + Intergenic
1117678588 14:58180370-58180392 TTTAAGATAAGCAACCTTGTTGG - Intronic
1118217823 14:63826094-63826116 TTGAAAAAAAGTAACTAAGTTGG + Intergenic
1118364715 14:65084876-65084898 TTGAACAATAGCAGCTTTTGGGG + Intronic
1118585010 14:67344286-67344308 TAGAACACACCCAACTTTGTTGG + Intronic
1119458577 14:74778791-74778813 TTTCACAAATGCAACTTTATAGG - Intronic
1120104119 14:80474908-80474930 TTGAAAAAAAGGATCTTTGTAGG + Intergenic
1120343194 14:83247776-83247798 GTGAACAATAGCACCTTTTTGGG - Intergenic
1120345238 14:83280518-83280540 TGGAAAAAAAGGAAGTTTGTTGG + Intergenic
1120362422 14:83522120-83522142 TTGAACAAAAGCAATTGTAAGGG - Intergenic
1121301870 14:92878228-92878250 TTGATCAATAGCAACCTTGGAGG - Intergenic
1124195341 15:27621031-27621053 CGGAACTAAAGCAACTTAGTTGG - Intergenic
1124428176 15:29581173-29581195 CTAAACAAAAACAACTTTCTAGG + Intergenic
1125177084 15:36836478-36836500 TTGAAAAAAATCAACTATTTGGG - Intergenic
1125983524 15:44026505-44026527 GTGAAGAAAAGCAACAATGTAGG - Intronic
1127606017 15:60589616-60589638 TTAAACAAAAGCAAAATTGAAGG + Intronic
1129023356 15:72545032-72545054 TTAAACAAAGGAAAATTTGTGGG + Intronic
1129862199 15:78871785-78871807 CTGTTCAAAAACAACTTTGTTGG - Intronic
1130229415 15:82085387-82085409 CTGAACAAAAGGATCTTTATAGG - Intergenic
1130682006 15:86005218-86005240 GTGAAAAAAAGCAATTTTGAAGG + Intergenic
1130894008 15:88156772-88156794 TTCAAGAAAAGCAACCTGGTGGG - Intronic
1131934051 15:97482219-97482241 TTCAACAATAGCAAATTGGTTGG + Intergenic
1133186083 16:4099729-4099751 TTGAAAAAAATCACCTTTGGAGG + Intronic
1136404855 16:30038793-30038815 TTTATCCAAAGCAACCTTGTGGG + Intronic
1140107986 16:71978328-71978350 TTGGACAACAGAAACATTGTTGG - Exonic
1140194989 16:72848350-72848372 TTGATCATAAACAACTTTGAAGG - Intronic
1143937572 17:10502941-10502963 TTGCTCTAAAGCACCTTTGTTGG + Intronic
1144280433 17:13720852-13720874 TTAAAAAAAATCAACTTTATGGG - Intergenic
1144377401 17:14657860-14657882 TGGAAAAAAAGTACCTTTGTGGG - Intergenic
1144591781 17:16530377-16530399 TTCAAAAAGAGCAGCTTTGTTGG - Intergenic
1146085299 17:29822719-29822741 TTCCACAAAAGCAACTTTAACGG + Intronic
1148579057 17:48730414-48730436 TTGAACTTGAGCCACTTTGTGGG + Intergenic
1148598889 17:48879077-48879099 TAGAAAAAAAGCAACTTGGGCGG + Intergenic
1150036827 17:61810612-61810634 TTGAGAAAAAGCTACTTTATTGG - Intronic
1153636793 18:7119448-7119470 TTGATCAAAAGCAAACTTGGAGG + Intergenic
1154397039 18:14000265-14000287 TTGAACTAAATCAAATTTTTTGG + Intergenic
1155547753 18:26932430-26932452 TTGAAAAAAAACAACATTGATGG - Intronic
1155978880 18:32160398-32160420 TTTAACAAAAGCTACGTTTTAGG - Intronic
1157655435 18:49383042-49383064 ATGAACAAAATCTACGTTGTGGG + Intronic
1157985069 18:52427962-52427984 TTGAACAAGAGCTACTTTGGTGG - Intronic
1158284686 18:55866781-55866803 TTGATTATAAGCAACTTTGTGGG - Intergenic
1159924264 18:74253086-74253108 TTGAAAAAAAGAAACTATATCGG + Exonic
1159994209 18:74947182-74947204 AAGGACAAAAGCAATTTTGTGGG + Intronic
1163868612 19:19797801-19797823 TTGATCAAAAACATTTTTGTAGG + Intronic
1165501061 19:36189805-36189827 TAAAACAAAAACAACTTTATGGG - Intronic
1165908632 19:39209839-39209861 TTGAACATAAACAACATTATAGG + Intergenic
1167172420 19:47842210-47842232 TTGAATAAAAACCTCTTTGTGGG - Exonic
925408436 2:3624753-3624775 ATGAACAAAAGTGTCTTTGTAGG - Intronic
925704704 2:6673416-6673438 TAGAACAAAAGTATCTTTGAAGG - Intergenic
926038547 2:9654537-9654559 TTGAATAGCAGCAAGTTTGTGGG + Intergenic
926798773 2:16640624-16640646 TTGAGCAAAAGCAGCTCTGGAGG - Intronic
927116055 2:19903209-19903231 TAGAACAAAACCAAGTGTGTTGG + Intergenic
927378930 2:22454674-22454696 TTGAACAAAAGCAACTTAGGTGG - Intergenic
928122865 2:28596056-28596078 TAAAACAAAGGCAACTTTTTTGG - Intronic
928712782 2:34026059-34026081 ATGCACAAAAGCAATCTTGTAGG - Intergenic
928741177 2:34354573-34354595 TTGAACATAACCTACTTTGAAGG - Intergenic
928802763 2:35114730-35114752 TTGAGCAAAAGCAACAAAGTTGG + Intergenic
929104484 2:38350643-38350665 TTTAACAAAAGCACCACTGTGGG + Intronic
929611745 2:43275895-43275917 TTGAACAAAGGCCTCTGTGTGGG - Intronic
930723740 2:54663087-54663109 TTGAACAAAACTAATTTTGGGGG - Intronic
931102143 2:59014204-59014226 TTAAACAAAAGGAATTTTCTGGG - Intergenic
932280203 2:70484832-70484854 TTGAACAAAAGCAACTTTGTTGG - Intronic
932544196 2:72690043-72690065 CTGAACAAAAGCAACTTCTTTGG - Intronic
932653775 2:73589164-73589186 TTAAACAAAAACAACTTTTATGG - Intronic
934965028 2:98714054-98714076 TTGAGCATAAGCAACTATATTGG + Intronic
938225207 2:129609900-129609922 TAAAATAAAAGCGACTTTGTGGG + Intergenic
939651617 2:144769755-144769777 TTTTAAAAAAGCAACTCTGTGGG - Intergenic
939681921 2:145146816-145146838 TAGATCAAATGCTACTTTGTAGG + Intergenic
940144112 2:150526826-150526848 TTGAAAAAAATAAACTTTCTAGG + Intronic
940258496 2:151757263-151757285 TTAAAAAAATGCAAATTTGTGGG - Intergenic
940291313 2:152080001-152080023 TTCAATAAAAGCAATTATGTAGG - Intronic
940418503 2:153450786-153450808 TTGACCAAAAGAAACTTTGATGG + Intergenic
941101045 2:161295948-161295970 TTCAACAAGATCATCTTTGTTGG - Intergenic
941423539 2:165314599-165314621 GTGTACAAATGCAAGTTTGTGGG + Intronic
941677143 2:168355912-168355934 AGGAACAAAAGCCATTTTGTAGG - Intergenic
942138866 2:172956768-172956790 TTTTTAAAAAGCAACTTTGTGGG - Intronic
942887800 2:180949257-180949279 TTAAATAAAAACAACTTAGTGGG + Intergenic
944614043 2:201442012-201442034 TGAAACAAAAGGAAGTTTGTTGG - Intronic
945693299 2:213069488-213069510 TTGAACAAAGGCAACCTGCTAGG - Intronic
945838798 2:214864280-214864302 TTGGACAAAAGCCACTTTAGTGG - Intergenic
946551803 2:220809548-220809570 TTGACCAGAAACAACTTTGCTGG + Intergenic
947521760 2:230851065-230851087 TTTTACAAAATCAGCTTTGTAGG + Intergenic
948357328 2:237389534-237389556 GAGAACAAAAACAATTTTGTTGG - Intronic
1170223008 20:13961543-13961565 TTGAACAAAAGCCACTAGCTTGG + Intronic
1172135413 20:32683398-32683420 GTGAGCAAAATCAACCTTGTGGG - Intergenic
1175330423 20:58160011-58160033 TTGAACAAAGGCAACAGTGCGGG - Intronic
1176523173 21:7840577-7840599 TTTAACAACAGAAATTTTGTAGG + Intergenic
1177857525 21:26416197-26416219 GTGAAGAAAAACAAATTTGTTGG - Intergenic
1177949377 21:27515305-27515327 CTTAAGAAAAGAAACTTTGTAGG + Intergenic
1178449306 21:32680193-32680215 TTGAACAAAAGAAACTTTGCAGG + Intronic
1178657193 21:34470589-34470611 TTTAACAACAGAAATTTTGTAGG + Intergenic
1179603729 21:42498540-42498562 TGGAACACACCCAACTTTGTTGG + Intronic
1184710695 22:46247761-46247783 TTCATCAAATGCCACTTTGTTGG - Intronic
950221199 3:11197503-11197525 TTGAACAAAAGGTACTGTCTGGG + Intronic
951075018 3:18380041-18380063 TCTCACCAAAGCAACTTTGTAGG - Intronic
951309782 3:21110287-21110309 TTGAACAAAAGATACTTAGTCGG - Intergenic
951845368 3:27079136-27079158 TTCAACATCAGCAACTTTCTAGG - Intergenic
954022089 3:47751196-47751218 CTGAATAAAAGTTACTTTGTCGG - Intronic
954191842 3:48968508-48968530 TTGAACAAAAACAACCTGATGGG - Intronic
954926659 3:54241817-54241839 TTACATAAAAGCAACTGTGTTGG - Intronic
956839303 3:73122086-73122108 TTAAAACAAAGCTACTTTGTGGG + Intergenic
962151582 3:132899073-132899095 ATGAAGAAAAGAAACTTTATGGG + Intergenic
963471225 3:145744222-145744244 TTCAACAAAATCAATTTTTTTGG - Intergenic
963980997 3:151536733-151536755 TTGAACAAAATGAACTTTAAGGG - Intergenic
964086090 3:152820389-152820411 TTGAACTAAAGCAAGGTTGCAGG - Intergenic
964503959 3:157378167-157378189 TTGGCCAACAGCGACTTTGTGGG + Intronic
965477066 3:169170019-169170041 TTGATCAAAAGAGAGTTTGTAGG - Intronic
969263961 4:6052344-6052366 ATGAACAAAAGTCATTTTGTAGG + Intronic
970798579 4:19945183-19945205 TTGAACAGAAGCAATTTATTTGG + Intergenic
973791456 4:54381703-54381725 TTGAACAAAAAGAACTTTAGAGG - Intergenic
976278715 4:83305399-83305421 TAGATAAAAAGCAATTTTGTTGG + Intronic
976304205 4:83543282-83543304 TTGAACATAAGCACCCTTGAAGG - Intronic
977759536 4:100716892-100716914 TTGAAAAAAAGCAACATAATTGG + Intronic
978180166 4:105784494-105784516 TTAATCCAATGCAACTTTGTTGG - Intronic
978546946 4:109880288-109880310 TTGAAGAAATGCAATGTTGTGGG - Intergenic
983783997 4:171709404-171709426 TGGAACAAGAGGAACTGTGTTGG - Intergenic
987421610 5:17727301-17727323 TTGAATAAAAGCAATTATGTTGG + Intergenic
987505272 5:18761681-18761703 TTGAATAAAAGCAAATCTGAAGG - Intergenic
987691420 5:21271834-21271856 TTTAAAAAAAGAAACATTGTCGG + Intergenic
989373428 5:40733766-40733788 AGGAACATAAGCAGCTTTGTGGG - Intronic
989816171 5:45740373-45740395 TTGAAGAAAATCAACAGTGTAGG - Intergenic
990027920 5:51218532-51218554 TTGAACAACATCAACAGTGTTGG + Intergenic
990879400 5:60522480-60522502 TTGAAGAAAAGCACCTTTAGAGG - Intergenic
991375982 5:65967688-65967710 TTAACCAAAGGCATCTTTGTTGG - Intronic
991408426 5:66323878-66323900 TTGAACAAAATTACCTTTCTTGG - Intergenic
991547367 5:67797883-67797905 TTGAGCAAAAGCAACTGTTTAGG + Intergenic
991748957 5:69778304-69778326 TTTAAAAAAAGAAACATTGTGGG - Intergenic
991800536 5:70358115-70358137 TTTAAAAAAAGAAACATTGTGGG - Intergenic
991828064 5:70651926-70651948 TTTAAAAAAAGAAACATTGTGGG + Intergenic
991892894 5:71357555-71357577 TTTAAAAAAAGAAACATTGTGGG - Intergenic
992036227 5:72780555-72780577 TTGAACAAAAGGAACAATGCTGG + Intergenic
992839183 5:80670460-80670482 ATGAACACAAGAAACTTGGTGGG + Intronic
995012444 5:107272884-107272906 ATGAACAAACGCCCCTTTGTGGG + Intergenic
995155296 5:108904267-108904289 TTGAAAAAAAGCAAGATTGGGGG + Intronic
995517914 5:112972653-112972675 TTGAACCATAAGAACTTTGTAGG + Intergenic
996102052 5:119454196-119454218 TTTCACAAAATCAATTTTGTGGG - Intronic
998643343 5:144036590-144036612 TGGAAGAAAAGTAACTCTGTGGG - Intergenic
998705847 5:144759168-144759190 TTTAGCAAAAGCAACTCAGTGGG + Intergenic
1001316550 5:170645032-170645054 TTGAGCATAAGCACCCTTGTTGG + Intronic
1002676135 5:180914760-180914782 ATGAACAAAAGTATTTTTGTAGG + Intronic
1003905932 6:10699647-10699669 TTGCAGAAAACCAACTTTCTTGG - Intronic
1004223030 6:13762879-13762901 TTGCACAAAAGCAAGTTCCTGGG - Intergenic
1004942844 6:20579273-20579295 ATGAAGAAAGGCAACTTTGCCGG - Intronic
1005759404 6:28953992-28954014 TTGGACAAATGCAACTTCATGGG + Intergenic
1006913861 6:37582205-37582227 TTATAGAAAAGGAACTTTGTAGG + Intergenic
1008127831 6:47688806-47688828 AAGAACAAATGCAATTTTGTAGG + Intronic
1010134188 6:72531467-72531489 TTGCACAAAAGTAACATTTTGGG - Intergenic
1010626973 6:78149538-78149560 TTGAGCAAAATCAACAGTGTAGG + Intergenic
1010753782 6:79643925-79643947 TTGAATAAAACCAACTTGATGGG + Intronic
1010845175 6:80698011-80698033 TTCACCAAAAGCAACATTTTAGG - Intergenic
1011899804 6:92277750-92277772 TTGGTCAAAAACAACTTTTTAGG - Intergenic
1012427057 6:99126505-99126527 CTGAAAAAAAGCTACTATGTTGG - Intergenic
1013593312 6:111639045-111639067 TTGAAGAATAGCAAATTTGGAGG - Intergenic
1018969458 6:168516442-168516464 TTGGACAAAAGCAGCTTCCTTGG + Intronic
1020234550 7:6345725-6345747 TTTAAAAAAAGAAACTTTGAGGG - Intronic
1020682426 7:11253930-11253952 TAGAAGACAAGCAACTTGGTCGG + Intergenic
1021941327 7:25681623-25681645 TTGAGGAAAAGCAAGTGTGTTGG + Intergenic
1023649879 7:42358292-42358314 TGGAAAAAAACCAACTTTATAGG + Intergenic
1024142862 7:46480111-46480133 CTGAACAAAAGGAATTTTCTTGG + Intergenic
1025863863 7:65361533-65361555 TAGACCAAAAGCACCTTTGTGGG + Intergenic
1026478355 7:70757136-70757158 TTTGAAAAAAGCAATTTTGTGGG + Intronic
1026782329 7:73277123-73277145 TTGAAAAAGAGCAAATTTGGAGG + Intergenic
1027023089 7:74829945-74829967 TTGAAGAAGAGCAAATTTGGAGG + Intronic
1027064836 7:75115354-75115376 TTGAAGAAGAGCAAATTTGGAGG - Intronic
1028068411 7:86417668-86417690 TTTAATAAAATCAACTTTATAGG - Intergenic
1029152086 7:98487879-98487901 CAAAACAAAAACAACTTTGTGGG - Intergenic
1029685572 7:102145389-102145411 TTGGCCAAAAGCCCCTTTGTGGG + Intronic
1030661476 7:112223671-112223693 CTGGACAAAAGCGCCTTTGTGGG - Intronic
1031137519 7:117901114-117901136 TTGATCAAATGTCACTTTGTCGG - Intergenic
1031222488 7:118987813-118987835 TTGTAAAAATGCCACTTTGTAGG - Intergenic
1031518993 7:122739540-122739562 GTGAACTATATCAACTTTGTTGG - Intronic
1032309371 7:130769032-130769054 TTTCTCAAAAGAAACTTTGTAGG + Intergenic
1032679409 7:134166897-134166919 GTGAGCAAAAGGAACTTTGGGGG + Intronic
1033218550 7:139512265-139512287 TAGAACAGTACCAACTTTGTGGG - Intergenic
1036083428 8:5584736-5584758 TTTAACAGAATCAACTTTGGAGG - Intergenic
1036514571 8:9431818-9431840 TCGAACAAACTCAAGTTTGTTGG - Intergenic
1040762537 8:50867423-50867445 TTGAACAAGAACAACTTTGGAGG - Intergenic
1044015099 8:87041395-87041417 TTGCACAAAAGCAACCACGTCGG + Intronic
1044093889 8:88038157-88038179 TTGTACACCAGCTACTTTGTGGG - Exonic
1044188614 8:89285163-89285185 TTAAAAAAAAACAACTTTCTAGG - Intergenic
1046441905 8:114267097-114267119 TTGATCAAAAGTATCTTTATAGG - Intergenic
1046565796 8:115899206-115899228 GTGAACAAAAGGAATTATGTAGG - Intergenic
1046583836 8:116126600-116126622 TTGAAAAAGAGCAAGTTTATTGG - Intergenic
1047791396 8:128207270-128207292 TTGAACAAATGTGACTTAGTAGG - Intergenic
1048374002 8:133805965-133805987 TTGAGCAACAGCAGCTTTGTTGG - Intergenic
1048906509 8:139094326-139094348 AGCAACAAAAGAAACTTTGTGGG + Intergenic
1050154242 9:2649107-2649129 TAGCACAAAAGCTACTTTGGAGG - Intronic
1051088461 9:13379186-13379208 CTGAACAAAAGCAATTGTCTGGG - Intergenic
1051128070 9:13827665-13827687 AGGAACAAAAGGAACATTGTAGG - Intergenic
1051866323 9:21687292-21687314 TTGAACAAAATCAAGTTGGGAGG + Intergenic
1051878100 9:21811926-21811948 ATGAACAGCAGCTACTTTGTTGG - Intronic
1053357757 9:37461096-37461118 ATGATCAAAAGCAACTCTGCAGG - Intronic
1053455438 9:38229999-38230021 TTGAAGAAAAGCAAGTAAGTTGG + Intergenic
1055615234 9:78065256-78065278 TTCAACAAAAGGAATTTTTTTGG - Intergenic
1056389310 9:86126133-86126155 TTTAAAAAAAGCAACTTTGTTGG - Intergenic
1056996283 9:91463157-91463179 TTGAAAATAAGAAACTATGTAGG - Intergenic
1057023761 9:91720643-91720665 TTGAATAATAGCGACTTGGTTGG - Intronic
1058725911 9:107803927-107803949 GTGAACCAAAGCAACTTAGCAGG - Intergenic
1185685799 X:1927260-1927282 ATAAACAAAGGCAACTTTCTGGG + Intergenic
1185711643 X:2308724-2308746 ATGAACAAAATCAACATTGTGGG + Intronic
1188588434 X:31804443-31804465 TTGGATAAGAGCAACTTTGGAGG - Intronic
1188888149 X:35575968-35575990 TTTAACAAAGGCAAATTTGATGG - Intergenic
1190139190 X:47827151-47827173 TTGAACATGATCAACTTTGTTGG - Intergenic
1190925341 X:54898703-54898725 TTGGACAACATCCACTTTGTTGG - Intergenic
1191963111 X:66725572-66725594 TTAAAAAGAAACAACTTTGTGGG + Intergenic
1194194589 X:90877246-90877268 TTGAAAAAAAATAAATTTGTGGG - Intergenic
1194467229 X:94247791-94247813 TTGAACAAAAAAAATGTTGTGGG - Intergenic
1195606107 X:106807392-106807414 ATGAGAAAGAGCAACTTTGTAGG + Intronic
1197483572 X:127018367-127018389 TTGAACGAAAAAATCTTTGTTGG - Intergenic
1200936494 Y:8742934-8742956 TAGAACAAAAGCTTCCTTGTTGG + Intergenic