ID: 932280945

View in Genome Browser
Species Human (GRCh38)
Location 2:70491384-70491406
Sequence CAAGCTGAAAACTTTGGTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 210}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932280945_932280949 10 Left 932280945 2:70491384-70491406 CCCAAACCAAAGTTTTCAGCTTG 0: 1
1: 0
2: 0
3: 24
4: 210
Right 932280949 2:70491417-70491439 GAAGTCATCCATACCACACCAGG 0: 1
1: 0
2: 0
3: 8
4: 93
932280945_932280950 15 Left 932280945 2:70491384-70491406 CCCAAACCAAAGTTTTCAGCTTG 0: 1
1: 0
2: 0
3: 24
4: 210
Right 932280950 2:70491422-70491444 CATCCATACCACACCAGGCAAGG 0: 1
1: 0
2: 0
3: 19
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932280945 Original CRISPR CAAGCTGAAAACTTTGGTTT GGG (reversed) Intronic
901802164 1:11714635-11714657 CAGGGTGAAAACAATGGTTTGGG - Intronic
903486691 1:23694696-23694718 GATACTGGAAACTTTGGTTTTGG + Exonic
904386158 1:30143508-30143530 CAAGCTAAGAACTGAGGTTTGGG - Intergenic
906979363 1:50612652-50612674 CATGCTAACAACTTTGGTCTCGG + Intronic
907336869 1:53705434-53705456 CAAGAGGAAAAGTTTGCTTTTGG - Intronic
907477669 1:54716186-54716208 TAAGCTGAGAACCTAGGTTTTGG + Intronic
908092272 1:60698755-60698777 CAAGAGGAAGACTTGGGTTTTGG + Intergenic
908648589 1:66307239-66307261 CAACCTGAAAGCTTTTCTTTAGG - Intronic
908803759 1:67908332-67908354 CAAGCTGAAACATTTGGACTTGG + Intergenic
908832823 1:68197689-68197711 CCAGCTGTAAGCTTTGCTTTTGG - Intronic
909424682 1:75509242-75509264 CAAACTGAAAGCTTGAGTTTGGG + Intronic
910050458 1:82967683-82967705 AAAGCTGACAACTTTGATTAAGG - Intergenic
910879260 1:91907745-91907767 CATGCTGAAGTCTTTGTTTTTGG - Intergenic
913465871 1:119141967-119141989 AAAGCTGATCAGTTTGGTTTTGG + Intergenic
915169447 1:153967795-153967817 GAAGCTGAAGACTTAGGTTTCGG - Intronic
916262974 1:162861010-162861032 CATGGTGAAAACTCTGGATTTGG - Intronic
916616417 1:166446001-166446023 CAAGCTGAATAATGTGGTTATGG - Intergenic
921363242 1:214350024-214350046 AAAGCTGAAAAGATTGGATTGGG - Exonic
922918027 1:229274527-229274549 CAAATTGAAATCTTAGGTTTTGG + Intronic
923349173 1:233086908-233086930 CAAGCTGAGAGCTGTGTTTTAGG + Intronic
1063668949 10:8084251-8084273 CAAGGTGACAACTTTTATTTGGG - Intergenic
1065551183 10:26869814-26869836 CAAGCTGAAAGCTCTGGTGTGGG + Intergenic
1066792350 10:39079813-39079835 CAAGTTGAAAACTCTCTTTTTGG + Intergenic
1069964344 10:72101699-72101721 CAAGATGAAAACCATGTTTTAGG + Intronic
1071447360 10:85761288-85761310 AAAGCTGCTATCTTTGGTTTGGG - Intronic
1071701693 10:87945798-87945820 GATACTGGAAACTTTGGTTTTGG + Intronic
1072853703 10:98924653-98924675 CAAGCTGCAATCCTGGGTTTGGG + Intronic
1073108040 10:101043866-101043888 CAAAAGGAACACTTTGGTTTGGG + Intergenic
1073508276 10:104022462-104022484 CAAACTTAAACCTTTGTTTTGGG + Intronic
1073672920 10:105612508-105612530 TAAGCTGAAAACTTACCTTTTGG - Intergenic
1074653416 10:115552819-115552841 AAAGATGAAAACTTTCTTTTGGG + Intronic
1079968975 11:27012922-27012944 TAAACTGAACACTTTGGGTTTGG - Intergenic
1080675244 11:34420464-34420486 CATGCTCAAAACTGTGTTTTAGG - Intergenic
1084098629 11:66930336-66930358 AAACCTCAAATCTTTGGTTTCGG + Intronic
1086140693 11:83495658-83495680 TAAGCTGAAAATATTGTTTTGGG - Intronic
1086291839 11:85319899-85319921 CAAGCTGTAAACTTTGACTTAGG - Intronic
1086898832 11:92343300-92343322 CCAGCTGAAGGCTTTGGTTAGGG + Intergenic
1091745124 12:2987065-2987087 CAAGCTGAACACTTGGTTTTGGG + Intronic
1093567400 12:20624339-20624361 GAAGCTGAAAATTATGGTTAGGG + Intronic
1095329381 12:40939430-40939452 CTCCATGAAAACTTTGGTTTCGG - Exonic
1097676442 12:62607278-62607300 CAAGTTGAAAATTTTTTTTTTGG + Intergenic
1102443270 12:112979654-112979676 CAAGCTGGACACTTTGATCTGGG - Intronic
1105595595 13:21834757-21834779 CAAGGTGAAAAATCTGGTTTTGG + Intergenic
1106364317 13:29062964-29062986 CATGCTTAAAACTTTGAGTTTGG + Intronic
1107384387 13:39892388-39892410 AAAGATGAAAAATTTGGATTAGG - Intergenic
1107442895 13:40444055-40444077 CCAGCTGAAAATTTTGCTTTTGG + Intergenic
1108223499 13:48263423-48263445 CATGCTGGAAACTGTGGTCTTGG + Exonic
1114804990 14:25824828-25824850 CATGCAGAAAACTTTCCTTTGGG - Intergenic
1114953382 14:27785730-27785752 CAAATTTCAAACTTTGGTTTAGG - Intergenic
1118001076 14:61524429-61524451 CAAGCCGGTAACTGTGGTTTTGG + Intronic
1119403600 14:74381344-74381366 CAAGCTGTATACTTGTGTTTGGG + Intergenic
1119552259 14:75523516-75523538 CAAGCTAAAACCTTTGGACTTGG - Intronic
1120433171 14:84444950-84444972 AAAGCCAAATACTTTGGTTTGGG + Intergenic
1120534249 14:85673495-85673517 CAAGCTGTGAAATTTGCTTTAGG + Intergenic
1120981795 14:90296575-90296597 CACCATGAAAACTTTGGATTAGG - Intronic
1121133033 14:91466729-91466751 CAAACTGAAAATATTGTTTTGGG - Intronic
1122241979 14:100375209-100375231 AGTGCTGAAAACCTTGGTTTAGG - Intronic
1125230619 15:37451219-37451241 CAAGATGAACACTTTGGTAAAGG - Intergenic
1125975451 15:43947385-43947407 CATGCTGATAACTTTGAGTTTGG + Intronic
1130211424 15:81926444-81926466 AATGCTGAAAACTGTGGTCTGGG - Intergenic
1132056139 15:98650849-98650871 CAATCTGATAGCTTTTGTTTTGG + Intronic
1132313615 15:100875418-100875440 TAAGCTGAAGTTTTTGGTTTGGG - Intergenic
1137253491 16:46757274-46757296 TCAGCAGAAAGCTTTGGTTTAGG - Intronic
1139260096 16:65583594-65583616 GCATCTGAAAACTTTGATTTTGG + Intergenic
1139660676 16:68418807-68418829 CAAGCTCAAGACTATGGTTCAGG - Intronic
1140388705 16:74565840-74565862 CAAACTAAAAAGTTTGGTTTAGG + Intronic
1143350359 17:6283729-6283751 GAGTCTGAAAACTTTGGTTTGGG - Intergenic
1143715600 17:8766231-8766253 CAAGCTGGAAACACTGGTATAGG - Intergenic
1143943325 17:10566252-10566274 AAAGTTGAAAACTTTGTTCTGGG - Intergenic
1146071127 17:29682938-29682960 CAAGCTAATAACTTTGGCTTTGG + Intronic
1146918770 17:36695748-36695770 GAGGCTGAAAACTTAGGCTTGGG + Intergenic
1148289182 17:46428195-46428217 TAAGCAGAAAACTTTACTTTTGG + Intergenic
1148311351 17:46645772-46645794 TAAGCAGAAAACTTTACTTTTGG + Intronic
1149064226 17:52461059-52461081 GAAGGTGAAATATTTGGTTTTGG + Intergenic
1149277569 17:55060927-55060949 CAAGCTAAATATTTTGGCTTTGG - Intronic
1150844310 17:68639554-68639576 CAAGTTGAAAACTTTTTGTTTGG + Intergenic
1152546062 17:81000590-81000612 GAAGCTGAAGACCTGGGTTTGGG + Intronic
1153117282 18:1675074-1675096 CAAGTGGAAGACTTTGCTTTAGG + Intergenic
1153604314 18:6816596-6816618 GAAGGCGAAATCTTTGGTTTTGG + Intronic
1153853383 18:9118908-9118930 CAATCTGATAACCTTGCTTTTGG + Intronic
1155515219 18:26617789-26617811 CAAGCTCACAGCTGTGGTTTTGG - Intronic
1156318262 18:35992379-35992401 CAAGAGGACAACTTTGGTTCTGG - Exonic
1156466586 18:37351561-37351583 AAAGCTGAAAACTGTGTTTCTGG - Intronic
1156732685 18:40213868-40213890 TAATCTCATAACTTTGGTTTAGG + Intergenic
1158045459 18:53149956-53149978 GAAGCTCGAAAATTTGGTTTGGG - Intronic
1158776596 18:60589434-60589456 CAAGGTGGAACCATTGGTTTTGG - Intergenic
1160213231 18:76902113-76902135 GAACCTGAATTCTTTGGTTTAGG + Intronic
1164729349 19:30490811-30490833 TAAAGTGAAAACTTTGGGTTTGG + Intronic
925734459 2:6949092-6949114 CTAGTTGAAAACTTTGGTGCAGG + Intronic
926293033 2:11545504-11545526 CATGCTCCAAACTTTGGGTTAGG - Intronic
926732824 2:16050050-16050072 CAAGCTGATGAATTTGGTCTGGG - Intergenic
927128330 2:20034210-20034232 CATGCTGTAACCTATGGTTTGGG - Intronic
928506517 2:31959101-31959123 TAAGATGAAGACTTTGATTTTGG + Intronic
928677350 2:33662575-33662597 CAAGCTTAACACTGGGGTTTGGG - Intergenic
929306423 2:40367976-40367998 GAATCTTAAACCTTTGGTTTAGG + Intronic
929470335 2:42185681-42185703 CATGCTGAAGAGTTTGGCTTTGG + Intronic
930626526 2:53704530-53704552 GAAGCTGAAAAATATGTTTTTGG - Intronic
930925687 2:56816121-56816143 AAAGCAGAAGGCTTTGGTTTTGG + Intergenic
931447182 2:62336514-62336536 CCTGGTGAAGACTTTGGTTTTGG - Intergenic
932280945 2:70491384-70491406 CAAGCTGAAAACTTTGGTTTGGG - Intronic
934483938 2:94683720-94683742 CAAATTTCAAACTTTGGTTTAGG + Intergenic
934679808 2:96275360-96275382 CATGCTGAAATTCTTGGTTTTGG - Intronic
935942928 2:108260254-108260276 CCAGCTGTAGACTTTGGGTTGGG + Intronic
939276109 2:139998587-139998609 AAAGCTCAAAAGTTTGGTTTTGG + Intergenic
940086869 2:149869531-149869553 CAATGTCAAATCTTTGGTTTTGG + Intergenic
943850363 2:192713201-192713223 CAAGTTGAATACCTTGTTTTAGG - Intergenic
946859812 2:223990041-223990063 GAAGCTGAAACCTTTGGTAGAGG + Intronic
947304646 2:228730661-228730683 CAAGATTAAAATTATGGTTTAGG + Intergenic
1170460235 20:16570957-16570979 AAAGCTGAAAATGTGGGTTTAGG - Intronic
1172898358 20:38316344-38316366 GAACCTGAAGAGTTTGGTTTGGG + Intronic
1174932179 20:54827849-54827871 AATGATGAAAACTTTGGTTCTGG + Intergenic
1177216681 21:18139238-18139260 CAAGCGGAAGACTGTGATTTAGG + Intronic
1177317697 21:19481508-19481530 CAAGCTGACAACATTGTTTATGG - Intergenic
1177505185 21:22011022-22011044 CAAACTAAAAACTTTGCATTGGG + Intergenic
1177908006 21:26995127-26995149 ACAGGTGAAAATTTTGGTTTTGG + Intergenic
1181455378 22:23057292-23057314 CCAGCTGATATCTTTGGTTTTGG + Intergenic
1184211976 22:43041397-43041419 CAACCTGCAAACTCTGGTTTTGG - Intronic
950728308 3:14934051-14934073 CAAGCTGACAACATTGTTTATGG + Exonic
953783318 3:45891387-45891409 CAAAATGAAAACAATGGTTTGGG - Intronic
953928584 3:46994805-46994827 CAGGCTGAAAACTAAGGTTGAGG + Intronic
954505273 3:51065119-51065141 CAATTTGAAGACTTTGGTATGGG + Intronic
963916023 3:150859440-150859462 CAAGCTTAACACTGTGGCTTGGG - Intergenic
965631777 3:170740634-170740656 CATTCTGAAAACTGGGGTTTAGG + Intronic
966458625 3:180147813-180147835 GAAGCCGAGCACTTTGGTTTGGG - Intergenic
967143313 3:186582907-186582929 AAGGCTGAAAACTTGGGGTTGGG + Intronic
967623808 3:191663687-191663709 CAAGCTTAACACTGGGGTTTGGG - Intergenic
967858776 3:194136673-194136695 CCAGCTGAAAACACTGATTTTGG + Exonic
969693487 4:8721254-8721276 CAAGCTGGAATCTTTGGTGAAGG - Intergenic
971623475 4:28887236-28887258 CAAGATTAGAAATTTGGTTTAGG - Intergenic
972294849 4:37727621-37727643 CAAGCTGAAACACTTGTTTTGGG + Intergenic
972778039 4:42261418-42261440 AAAGCTGCAGTCTTTGGTTTTGG + Intergenic
974703761 4:65485640-65485662 CAAGTTGAAAATTTTGCATTAGG - Intronic
975422816 4:74189091-74189113 CAAGGCGATAACTTTTGTTTGGG + Intronic
979144680 4:117229194-117229216 AAAGCTGAAAATCTTGGTGTTGG - Intergenic
979412874 4:120400647-120400669 CAAGCTGGGAACTGTGGTATAGG + Intergenic
979560565 4:122096922-122096944 CAAGCTGAAAACCTTAGCCTGGG + Intergenic
980347738 4:131644554-131644576 AAAGGTGAAAACTTGGTTTTTGG + Intergenic
980547080 4:134278845-134278867 TAAGTTGAAAACTTTGATTTAGG + Intergenic
981124336 4:141088837-141088859 GAAGGTGAAAACTGTGGTTCTGG - Intronic
982463672 4:155703606-155703628 CAAACTGAAATCTTCTGTTTGGG + Intronic
982653939 4:158122320-158122342 AAAGGTGAAAACTTAGGTTTTGG - Intergenic
984021728 4:174493024-174493046 CAAGCTTCAAACTTTTGGTTTGG - Intronic
984729922 4:183058444-183058466 CTAACTCAAAACTCTGGTTTGGG - Intergenic
986133467 5:4952248-4952270 CAAGGTAAACACTTTGGTTTAGG + Intergenic
989770203 5:45135776-45135798 CTTGCTGTAAACTTTGGTGTGGG - Intergenic
990154367 5:52857959-52857981 CAAGACAAAAACTTTGGTTCAGG - Intronic
992121372 5:73596727-73596749 AAACCTGAAAAATTTGTTTTTGG + Intergenic
995073574 5:107953622-107953644 GAAGGTGAAGACTTTGCTTTTGG - Intronic
996132280 5:119796047-119796069 CAAGTTAGAAACTATGGTTTAGG - Intergenic
996790399 5:127287862-127287884 CAATCTGAACAGTATGGTTTTGG + Intergenic
997190634 5:131931568-131931590 GAAGCTGAAAACTGTGGTATGGG + Intronic
998500963 5:142632284-142632306 CAAGGAGAAAACCTTGGCTTGGG - Intronic
999763471 5:154720785-154720807 CAGGCTGAGAACCTTTGTTTTGG + Intronic
999906729 5:156149457-156149479 TAAGCTGAAAACATTAGTTCAGG - Intronic
999917258 5:156276370-156276392 AAAGCTGAAAACCTTGGTCGAGG - Intronic
1001469066 5:171995943-171995965 CAAGCTTTAAGCTTGGGTTTAGG - Intronic
1001495319 5:172184174-172184196 CAAGATGGAATTTTTGGTTTGGG + Intronic
1004115323 6:12761048-12761070 CAAGCAGCAGACTTGGGTTTTGG - Intronic
1004287759 6:14338413-14338435 AAAGTTGAAAGCTTAGGTTTGGG + Intergenic
1004529403 6:16439692-16439714 CAAAATGAAAAGTTTGATTTCGG - Intronic
1005064923 6:21808423-21808445 CATGCTGTAAACTTTGGTAGTGG + Intergenic
1005131956 6:22519469-22519491 AAAGCACAAAACTTAGGTTTGGG + Intergenic
1006688375 6:35857469-35857491 CAAAGTGAGAACTTTGGTTTGGG - Intronic
1008107572 6:47455972-47455994 GAAACTGAAAAATTTGCTTTAGG + Intergenic
1009403824 6:63288684-63288706 CCTGCTGACACCTTTGGTTTCGG - Intronic
1009409038 6:63344082-63344104 CAAAATCAAAACATTGGTTTTGG + Intergenic
1010878960 6:81144451-81144473 CAACCTGAAAACTTCAATTTAGG - Intergenic
1010893720 6:81342295-81342317 CAAGCTTAACACTGTGGCTTGGG - Intergenic
1011014021 6:82735370-82735392 AAAGCTGCAAAGTTTGGTTTTGG + Intergenic
1011176691 6:84569422-84569444 CAAGCTAATAATTATGGTTTAGG + Intergenic
1011539597 6:88416063-88416085 CAAGCTTACAACTGGGGTTTGGG + Intergenic
1011734847 6:90300045-90300067 AATGCTGAAACATTTGGTTTTGG + Intergenic
1011827947 6:91332534-91332556 GAAGTTGGAAAATTTGGTTTTGG - Intergenic
1011891482 6:92166990-92167012 AAAGCTGAAAATATTTGTTTGGG - Intergenic
1012300364 6:97579984-97580006 CAAGCTGGACACCTTAGTTTAGG + Intergenic
1013395876 6:109739000-109739022 CAAGCTGAGGACTTTGGGTTTGG + Intronic
1014096216 6:117465100-117465122 CAAACTAAACAGTTTGGTTTGGG - Intronic
1014474468 6:121855259-121855281 CAAGATAAAAACTCAGGTTTAGG - Intergenic
1014694158 6:124597759-124597781 CAAGCTGAAACCATTTGTTCAGG - Intronic
1015314037 6:131796884-131796906 TAAGCTGAAATCTTAGATTTGGG + Intergenic
1015344687 6:132142286-132142308 AAACCTGAAAACTGTGGTATGGG - Intergenic
1017794919 6:157835371-157835393 AAGGCTGAAAACTTTGCTTTTGG - Intronic
1018116826 6:160594538-160594560 GAAGCTGAAGGCTTTGGCTTTGG - Intronic
1018148205 6:160913038-160913060 GAAGCTGAAGGCTTTGGCTTTGG + Intergenic
1018761305 6:166896376-166896398 CAAGCTGAACACTGGGGCTTGGG - Intronic
1018828748 6:167425758-167425780 CAAGTTGAAAACTCTGGTCATGG - Intergenic
1019095214 6:169574381-169574403 GAGGCTCAAAACTTTAGTTTTGG + Intronic
1020388159 7:7630562-7630584 GCAGCTGAAAACTTAGGTTGGGG + Intergenic
1022123077 7:27328931-27328953 CATTCTGGAAACTTTGGTGTTGG - Intergenic
1023304580 7:38811794-38811816 TACTCTTAAAACTTTGGTTTGGG - Intronic
1023646480 7:42322151-42322173 AAAGGGGAAAACATTGGTTTAGG - Intergenic
1024083365 7:45873868-45873890 CACACTAAAAACTTTGCTTTGGG - Intergenic
1024760024 7:52584666-52584688 CAAACAGAAAACTGAGGTTTTGG + Intergenic
1026407735 7:70085134-70085156 CAATTTGAAACCTTTGCTTTGGG - Intronic
1027155649 7:75765679-75765701 CAATCTCAGCACTTTGGTTTGGG + Intergenic
1028691282 7:93654471-93654493 CAAGCTAAAAATTTTTCTTTTGG + Intronic
1028723074 7:94056295-94056317 CAAGCTGAACACATTGGCTTTGG + Intergenic
1028811856 7:95096872-95096894 CAGGCTGAAGTCTTTGCTTTCGG + Intronic
1029115104 7:98232641-98232663 CATCCTGAAGACTTTGGTTTGGG - Intronic
1029725021 7:102397054-102397076 CTAGCTGGAAACTATGGCTTAGG + Intronic
1029919714 7:104250207-104250229 TAACCTGAAAACTTTGGTAGAGG - Intergenic
1030087519 7:105829662-105829684 CATGCTGAAATCTATGATTTTGG - Intronic
1032600187 7:133285701-133285723 CAATCTGAAAACTCATGTTTTGG + Intronic
1033561086 7:142531701-142531723 CAAGTTTAAAAATTTGCTTTTGG - Intergenic
1036183300 8:6603067-6603089 CAGGCTGAAAACTAGTGTTTGGG - Intronic
1037156891 8:15712412-15712434 CAAGTTGAAGATCTTGGTTTTGG - Intronic
1038531101 8:28318449-28318471 TATGTTGAAAACTCTGGTTTGGG - Intronic
1040124938 8:43726521-43726543 CAGGTTGAAAACTTTCTTTTTGG + Intergenic
1040131185 8:43798623-43798645 CAAGCTGGAAACATTCTTTTTGG + Intergenic
1040136522 8:43860848-43860870 CAGGCTGGAAACTTTCTTTTTGG + Intergenic
1041451018 8:58006929-58006951 CAAAATGCAAACTCTGGTTTTGG - Intronic
1041678697 8:60564170-60564192 TCAGCTGATAACCTTGGTTTTGG + Intronic
1041691253 8:60689833-60689855 TAAGCTGAATACTTTGATGTCGG - Intronic
1041809485 8:61891693-61891715 TGAGCTAAAAACTTTGCTTTTGG + Intergenic
1042039565 8:64577822-64577844 GTCGCTGAAAACTTTGCTTTGGG - Intergenic
1044738517 8:95302592-95302614 AAAACTGAAAGCTTTGTTTTAGG + Intergenic
1045398923 8:101791728-101791750 TAAGCTGAAAACTGTGCTTTGGG + Intronic
1046535597 8:115504848-115504870 CAAAATGAAAACTCTTGTTTAGG + Intronic
1047289006 8:123512935-123512957 AAAGCTGGAAACTTGGCTTTTGG - Intronic
1048443626 8:134477723-134477745 CAAGTTGAAATCTTGGATTTGGG - Intergenic
1051551051 9:18329701-18329723 AGACATGAAAACTTTGGTTTTGG - Intergenic
1051848349 9:21478321-21478343 CAAGTTTAGAACTCTGGTTTTGG + Intergenic
1051941927 9:22517270-22517292 CAAGTAGAAATCTTTGGTTCCGG - Intergenic
1056873350 9:90305155-90305177 CAATGTGAAAGCTTTGTTTTTGG + Intergenic
1058509588 9:105702937-105702959 CAATCACAACACTTTGGTTTGGG - Intronic
1059571278 9:115439007-115439029 AAAGCTGTAAAGTTTGATTTTGG + Intergenic
1059850862 9:118337773-118337795 CAAGCTGAAGAATTTCCTTTAGG + Intergenic
1060541520 9:124433752-124433774 CAAGGGGAAACCTTTGGATTAGG + Intergenic
1060577759 9:124712645-124712667 CAAGATTAAAACATAGGTTTTGG + Intronic
1191129448 X:56992711-56992733 CAATGAGAAAGCTTTGGTTTTGG + Intronic
1192033099 X:67535903-67535925 CTAACTGAAAACTTTGGTTAGGG - Intergenic
1194958434 X:100208135-100208157 CCAGCTGTAAACTCAGGTTTAGG + Intergenic
1196700908 X:118667192-118667214 TGAGCAGAAAATTTTGGTTTTGG + Intronic
1198230946 X:134688910-134688932 AAAGGTGAAACATTTGGTTTTGG - Intronic
1198977480 X:142352993-142353015 CAAGATGAAAAGTTTCATTTTGG - Intergenic