ID: 932281818

View in Genome Browser
Species Human (GRCh38)
Location 2:70499391-70499413
Sequence GAGTATCCCAGGGCCCGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 104}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932281812_932281818 0 Left 932281812 2:70499368-70499390 CCTGAACTATCAGTTTTCCTGGG 0: 1
1: 0
2: 2
3: 14
4: 140
Right 932281818 2:70499391-70499413 GAGTATCCCAGGGCCCGCAGTGG 0: 1
1: 0
2: 0
3: 7
4: 104
932281810_932281818 24 Left 932281810 2:70499344-70499366 CCACTTGCTGATATGGAGGTCTA 0: 1
1: 0
2: 0
3: 3
4: 78
Right 932281818 2:70499391-70499413 GAGTATCCCAGGGCCCGCAGTGG 0: 1
1: 0
2: 0
3: 7
4: 104
932281809_932281818 25 Left 932281809 2:70499343-70499365 CCCACTTGCTGATATGGAGGTCT 0: 1
1: 0
2: 0
3: 5
4: 89
Right 932281818 2:70499391-70499413 GAGTATCCCAGGGCCCGCAGTGG 0: 1
1: 0
2: 0
3: 7
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932281818 Original CRISPR GAGTATCCCAGGGCCCGCAG TGG Intronic
900658945 1:3773291-3773313 GAGCCTCCCAGGGCCTGGAGGGG + Intronic
900694791 1:4002968-4002990 GATCCCCCCAGGGCCCGCAGAGG + Intergenic
900885249 1:5410517-5410539 GAGTCTCCCAGGGCCCTCCCTGG - Intergenic
901779610 1:11585023-11585045 GAGCATCCCAGGGACCGGGGAGG + Intergenic
902512622 1:16974666-16974688 GAGTATCCCAGGCCTCTCTGTGG - Exonic
903069607 1:20720694-20720716 GGGTCTCCCATGGCCCGCTGAGG + Intronic
903221129 1:21870242-21870264 GAGGATCCCAGAGCCCCCAGAGG - Intronic
903280762 1:22248659-22248681 GAGTATGGGAGGGCCAGCAGTGG + Intergenic
903501690 1:23803819-23803841 GAGTCCACCAGGGCCCTCAGTGG - Intronic
903724461 1:25430768-25430790 GCCAATCCCAGGGCCCGCTGAGG - Intergenic
912124343 1:106515306-106515328 GAGTATCCAAGGGAGTGCAGTGG - Intergenic
912775355 1:112503190-112503212 CAGTATCCCAGGGACTCCAGTGG - Intronic
912975258 1:114323900-114323922 CAGTGTCCCAGGGCCCACTGAGG - Intergenic
913446217 1:118953435-118953457 GAGGATCCCAAGGCCCAGAGTGG - Intronic
919861313 1:201740807-201740829 GAGAGTCCCAGGGCCAGCTGTGG - Intronic
923240731 1:232082993-232083015 GAGTATAACAGGGCCAGCAGTGG - Intergenic
924744358 1:246818412-246818434 GAGTATCCCAGGCCTCTCTGTGG + Intergenic
1063148718 10:3318680-3318702 GAGTTTCCCAGGCCCCGGACGGG + Intergenic
1063502031 10:6563897-6563919 CAGCATGCCAGGGCACGCAGAGG + Intronic
1071803560 10:89091986-89092008 CAGCCTCCCAGGGCCCGCTGCGG - Intergenic
1076274060 10:129181781-129181803 GAGTAAGGCAGGGACCGCAGAGG - Intergenic
1076853056 10:133102559-133102581 CTGTATCCCAGGGCAGGCAGCGG - Intronic
1076999038 11:313453-313475 GAGGATTCCAGGGCCTGTAGGGG - Intronic
1077707176 11:4497824-4497846 GAGTATCCCGGGGACACCAGGGG - Intergenic
1083890360 11:65592756-65592778 GAGGTTCCCAGGGCCAGCGGAGG + Intronic
1084435441 11:69136695-69136717 GAGAAACCCAGGACCAGCAGAGG + Intergenic
1084706035 11:70816493-70816515 GGGTCACCCAGGGCCCCCAGAGG + Intronic
1091759572 12:3077753-3077775 GAGTAACCCGGGGCCGGCAAGGG + Intronic
1101883786 12:108644084-108644106 AAGTATCCCAGTGCTGGCAGTGG - Intergenic
1110434421 13:75463447-75463469 GAGATTCCCAGGGCCCACACTGG + Intronic
1111769226 13:92575460-92575482 GACTCTCCCAGAGCCTGCAGAGG + Intronic
1113821992 13:113221265-113221287 GAGTATCCCAGAGTCCTCACAGG + Intronic
1125504858 15:40261826-40261848 GGGTGTCCCAGGGCCAGGAGTGG - Intronic
1129767641 15:78180568-78180590 GCGTTTCCCAGGGCCTGCTGGGG - Intronic
1130370856 15:83284494-83284516 GAGAATCCCCGCGCCCGCGGAGG + Intronic
1132700304 16:1219441-1219463 CAGTTTCCCAGGGCCCACGGCGG + Intronic
1132705443 16:1241327-1241349 GAGTCTCCCGGGGCCTGGAGGGG + Intronic
1133274122 16:4626274-4626296 CTGTATCCCAGGCCCAGCAGCGG + Intronic
1141955823 16:87370667-87370689 CAGTGTCCCAGGGGCCGCAGTGG - Intronic
1142403832 16:89874694-89874716 GAGGATCGCAGAGCCCGCAGAGG - Intronic
1142994661 17:3753577-3753599 GAGCAGCCCAGGCCCCACAGCGG + Intronic
1143015453 17:3889072-3889094 CAGGCTCCCAGGGCCCCCAGGGG - Intronic
1143619486 17:8072934-8072956 AAGTGTCCCAGGGGCCGCTGCGG + Exonic
1143627502 17:8118876-8118898 GAGAAGCCCATAGCCCGCAGCGG + Exonic
1145961425 17:28888502-28888524 GATTACCCCAGGGCCTGCATGGG + Intronic
1151392617 17:73797806-73797828 GTGCATACCAGGGCCAGCAGTGG + Intergenic
1159565771 18:70046870-70046892 GAGTGTCACAGGGTCCTCAGGGG - Intronic
1160029771 18:75249050-75249072 CAGTAGCCCAGGGACCACAGTGG - Intronic
1161207241 19:3047375-3047397 GAGGGTCCCGGGGCCCGCTGGGG - Intronic
1161776291 19:6263970-6263992 GAGAAGCTCAGGCCCCGCAGTGG - Intronic
1164570870 19:29373366-29373388 GATGATCCCAGGGCCCACAGAGG + Intergenic
1165789915 19:38485223-38485245 GACCATCCCAGGGACCCCAGAGG + Intronic
927852351 2:26507736-26507758 CAGTATCCCAGGACCCTCTGAGG + Intronic
929496503 2:42449037-42449059 GGGTTTCCCAGGGCCCACTGAGG + Intronic
930906626 2:56576338-56576360 CAGGATCCCAAGGCCAGCAGTGG - Intergenic
931229037 2:60358543-60358565 GAGTTTCCTATGGCCAGCAGAGG + Intergenic
932281818 2:70499391-70499413 GAGTATCCCAGGGCCCGCAGTGG + Intronic
932862765 2:75311864-75311886 GGGTGTCCCGGGGCCTGCAGAGG + Intergenic
935209213 2:100923958-100923980 GAGGATCTCAGGGTCCTCAGAGG + Intronic
936951558 2:117982823-117982845 GTGAGTCCCAGGGCCAGCAGGGG + Intronic
937345741 2:121124338-121124360 GAGTTTCCCAGGTCTCCCAGTGG + Intergenic
939336894 2:140841063-140841085 GAGTATCAGAGGGCTAGCAGTGG - Exonic
947617928 2:231570122-231570144 GGTCATCCCAGGGCCCCCAGAGG - Intergenic
1169867532 20:10217782-10217804 GAGCATCCGAGGGCCCCCCGAGG + Intergenic
1171810733 20:29743059-29743081 GAGGATCCGAGGGCGCGGAGGGG + Intergenic
1172781845 20:37441364-37441386 GAGTAACCCAGGGCCCCAGGAGG - Intergenic
1173521754 20:43705151-43705173 GAGTATCCCTGAGACCTCAGGGG - Intronic
1173575580 20:44111196-44111218 GAGGATCCCAGGGACCCCAAAGG - Intergenic
1174987179 20:55468157-55468179 GAGTATATCAGGACCCTCAGAGG + Intergenic
1177909483 21:27012955-27012977 GAATATCCCAGGGTCCCCATTGG - Intergenic
1179712392 21:43270862-43270884 GAGTTTCCCAGGCACCGCGGCGG - Intergenic
1179842532 21:44086733-44086755 CAGCATCTCAGGGCCCGCAATGG - Intronic
1180274369 22:10631533-10631555 GAGTGTGGCAGGGCACGCAGCGG + Intergenic
1181278170 22:21699917-21699939 GGCTGTCCCGGGGCCCGCAGAGG - Exonic
1183405519 22:37628817-37628839 CAGTATTCCAGGGCAGGCAGAGG + Intronic
1183606105 22:38867478-38867500 GAGTGGCCCAGGGCCCTCTGTGG - Intronic
1183722198 22:39569007-39569029 TAGGATCCCAGGGACCCCAGTGG + Intergenic
1183934907 22:41256574-41256596 CAGCATCACAGGGCCCGAAGTGG + Intronic
1183942800 22:41305612-41305634 CTGTATCCCAGGGCCCCGAGGGG + Intronic
1184947454 22:47813679-47813701 AAGCAGCCCACGGCCCGCAGGGG - Intergenic
950677916 3:14565640-14565662 GAGGATGCCAAGGCCCGGAGTGG - Intergenic
952693885 3:36243013-36243035 GAGAATCCCTGTGCCCACAGGGG + Intergenic
953995810 3:47518839-47518861 GAGTATTCCAGGGCCAGGCGTGG + Intergenic
963903159 3:150751927-150751949 GAGACTCCCAGGGCTGGCAGGGG + Intronic
976226282 4:82797887-82797909 GAGAGCCCCAGGGACCGCAGAGG + Intronic
984551956 4:181171245-181171267 GAGTATGGCAGGGCCAGGAGAGG - Intergenic
984759647 4:183352570-183352592 GAGTGCCCCAGAGCCCGCAGAGG - Intergenic
985445883 4:190021203-190021225 GGGGATCCCAGGGCCCGCCCAGG - Intergenic
997485495 5:134226905-134226927 AAGTAGGCCAGGGCGCGCAGGGG - Intergenic
1003507400 6:6751283-6751305 TAGGATGCCAGGGCCCTCAGAGG + Intergenic
1006435967 6:34026441-34026463 GAGGATGCCAAGGCCTGCAGGGG + Intronic
1017786695 6:157762666-157762688 GAGTGTCCCGGAGCCCGCTGTGG + Intronic
1017955366 6:159173255-159173277 GACTAGCCCAAGGCCCCCAGAGG - Intronic
1018976989 6:168573666-168573688 GCGGATACCAGGGCACGCAGGGG - Intronic
1019062608 6:169266864-169266886 GTGTGTCCCAGGGCCCCCAGGGG + Intergenic
1019600749 7:1882526-1882548 GAGTCTCCCAGGGACTGCTGGGG + Intronic
1024647516 7:51382649-51382671 GAGGAGCCCTGGGCCCTCAGGGG + Intergenic
1032507918 7:132449951-132449973 CATTAGCCCAGGGCCCCCAGGGG - Intronic
1032983994 7:137316923-137316945 GAGTTTCCCAGGCCCCTTAGTGG + Intronic
1033551649 7:142452917-142452939 GAGTATGCCAGGACATGCAGTGG + Intergenic
1036443466 8:8801785-8801807 GAGGATCCCAGTGTCCACAGGGG + Intronic
1038938700 8:32280551-32280573 GAGATTCCCAGGGGCCGTAGAGG + Intronic
1039472328 8:37821223-37821245 GAGTAACCCAGGGCTGGGAGAGG - Intronic
1040380323 8:46865648-46865670 GACTCTCCCAGGGCCCTCTGAGG + Intergenic
1040776090 8:51044788-51044810 GAGGATAGCAGGGCCTGCAGTGG - Intergenic
1041442628 8:57913755-57913777 CAGTATCTCAGGGCCTCCAGGGG - Intergenic
1045242576 8:100415623-100415645 GAGTTTACCAGGGACCTCAGTGG + Intergenic
1055757243 9:79570680-79570702 GAACGTCCCAGGGCGCGCAGGGG + Intergenic
1059663062 9:116420469-116420491 GGATAACCCAGGGCCCACAGAGG + Intergenic
1060488992 9:124068180-124068202 GAGTAACCCAGGCCCGGGAGTGG - Intergenic
1061799230 9:133105101-133105123 GTGCATGCCAGGGCCCCCAGTGG + Intronic
1196198153 X:112856796-112856818 GAGTACCACAGGGACCACAGAGG - Intergenic