ID: 932282121

View in Genome Browser
Species Human (GRCh38)
Location 2:70502490-70502512
Sequence TCACCATGCCTGGCTAAGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 829
Summary {0: 1, 1: 1, 2: 13, 3: 137, 4: 677}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932282115_932282121 8 Left 932282115 2:70502459-70502481 CCTCCCGAGTAGCTGGGATTACA 0: 44593
1: 206846
2: 252437
3: 185282
4: 427506
Right 932282121 2:70502490-70502512 TCACCATGCCTGGCTAAGACGGG 0: 1
1: 1
2: 13
3: 137
4: 677
932282118_932282121 4 Left 932282118 2:70502463-70502485 CCGAGTAGCTGGGATTACAGGTG 0: 27298
1: 77225
2: 165100
3: 221696
4: 302720
Right 932282121 2:70502490-70502512 TCACCATGCCTGGCTAAGACGGG 0: 1
1: 1
2: 13
3: 137
4: 677
932282113_932282121 14 Left 932282113 2:70502453-70502475 CCTCAGCCTCCCGAGTAGCTGGG 0: 97626
1: 275854
2: 227041
3: 130261
4: 162635
Right 932282121 2:70502490-70502512 TCACCATGCCTGGCTAAGACGGG 0: 1
1: 1
2: 13
3: 137
4: 677
932282117_932282121 5 Left 932282117 2:70502462-70502484 CCCGAGTAGCTGGGATTACAGGT 0: 29735
1: 147997
2: 251626
3: 208111
4: 212677
Right 932282121 2:70502490-70502512 TCACCATGCCTGGCTAAGACGGG 0: 1
1: 1
2: 13
3: 137
4: 677

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932282121 Original CRISPR TCACCATGCCTGGCTAAGAC GGG Intronic
900197337 1:1383185-1383207 CCACCATGCCTGGCTAATTTTGG - Intergenic
900664761 1:3807755-3807777 CCACTGTGCCTGGCTGAGACTGG + Intergenic
900961303 1:5922700-5922722 CCACCGTGCCCGGCTAAGCCAGG - Intronic
900961311 1:5922736-5922758 CCACCGTGCCCGGCTAAGCCAGG - Intronic
900961319 1:5922772-5922794 CCACCGTGCCCGGCTAAGCCAGG - Intronic
900961327 1:5922808-5922830 CCACCGTGCCCGGCTAAGCCAGG - Intronic
900961335 1:5922844-5922866 CCACCGTGCCCGGCTAAGCCAGG - Intronic
901166964 1:7228313-7228335 CCACCATGCCCGGCTGAGTCCGG - Intronic
901498248 1:9635120-9635142 CCACCACGCCTGGCTAAGAGAGG - Intergenic
901856713 1:12049117-12049139 CCACCGCGCCTGGCCAAGACAGG + Intergenic
901869439 1:12128985-12129007 CCACCATGCCTGGCTAATTTTGG + Intronic
902176924 1:14657368-14657390 CCACCATGCCTGGCTGGGAGAGG + Intronic
902751992 1:18522594-18522616 ACACCATGCCTGGCTAATTTTGG - Intergenic
902894124 1:19467161-19467183 CCACCATGCCTGGCAACTACGGG + Intronic
902895358 1:19476033-19476055 CCACCATGCCTGGCCAAAATTGG - Intronic
903481502 1:23656870-23656892 TCACCATGCCTGGCCAAAGCTGG + Intergenic
903609019 1:24596528-24596550 CCACCATGCCTGGCTAATTTTGG - Intronic
903626997 1:24738023-24738045 CCACCATGCCTGGCTAATTTTGG + Intergenic
904190535 1:28739586-28739608 CCACCATGCCCGGCTGAGTCAGG + Intronic
904250435 1:29220101-29220123 CCACCATGCCTGGCCATGACTGG - Intronic
904650516 1:32002451-32002473 TCACCATGCCCGGCAAATAATGG - Intergenic
904682222 1:32237246-32237268 CCACCATGCCTGGCTAATTTTGG + Intergenic
905041532 1:34964009-34964031 CCACCACGCCTGGCCAAGAGTGG - Intergenic
905332868 1:37219223-37219245 CCACCATGCCTGGCTAATTTTGG - Intergenic
905339837 1:37270923-37270945 TCACCATGCCTGGCCAGCTCTGG - Intergenic
905615678 1:39396165-39396187 CCACCATGCCCGGCTAAGATGGG - Intronic
905858774 1:41332310-41332332 CCACCATGCCTGGCCTTGACTGG - Intergenic
906054231 1:42902306-42902328 TCACCACACCTGGCTTAGACTGG - Intergenic
906224197 1:44107390-44107412 CCACCGCGCCTGGCTGAGACTGG + Intergenic
906636054 1:47411499-47411521 TCACCCTGTCTGGCTAAGTGGGG - Intergenic
906801018 1:48736994-48737016 CCACCATGCCTGGCTGTCACTGG - Intronic
907195488 1:52683216-52683238 CCACCATGCCTGGCCAAAATGGG - Intergenic
907353609 1:53853960-53853982 TCACCATGCCTACCTGAGAAGGG - Intronic
907421686 1:54352006-54352028 CCACCAGGCCTGGCCAAGATCGG - Intronic
908005574 1:59724189-59724211 CCACCATGCCTGGCCAACACGGG - Intronic
908151411 1:61306426-61306448 CCACCATGCCTGGCTAATTTTGG + Intronic
908261629 1:62343691-62343713 CCACCACGCCCGGCCAAGACAGG + Intergenic
908391978 1:63691552-63691574 CCACCGCGCCTGGCTAAGAGAGG - Intergenic
908548061 1:65181537-65181559 CCACCATGCCTGGCTAATTTTGG + Intronic
908754354 1:67454465-67454487 CCACCACGCCTGGCCAAGAAGGG + Intergenic
908822320 1:68101260-68101282 GCACCATGCCTGGCAGAGAGGGG + Intronic
909360176 1:74750409-74750431 CCACCATGCCTGGCTAATTTTGG - Intronic
909625633 1:77712703-77712725 TCACCATGTCTGGCTAATTTTGG - Intronic
909674523 1:78224349-78224371 TCACCTTGCCTGGCAATGTCTGG + Intergenic
910986226 1:93007598-93007620 CCACCGTGCCTGGCCAAGAGAGG - Intergenic
912493141 1:110073407-110073429 CCACCATGCCTGTCTAAGATTGG + Intronic
912572813 1:110637041-110637063 CCACCATGCCTGGCTAATTTGGG - Intergenic
913006383 1:114636510-114636532 CCACCATGCCTGGCTAATTTTGG - Intronic
914320108 1:146551101-146551123 CCACCATGCCAGGCCAAGATGGG - Intergenic
915139560 1:153758818-153758840 CCACCATGCCTGGCCAGGCCTGG - Intronic
915286132 1:154853654-154853676 CCACCATGCCCGGCTGAGAGTGG - Intronic
915424469 1:155813142-155813164 CCACCGTGCCTGGCTGAGAATGG - Intronic
915491860 1:156254594-156254616 CCACCATGCCTGGCTAATTTTGG + Intronic
915950232 1:160185396-160185418 CCATCATGCCTGGCTATCACTGG + Intronic
916448233 1:164893811-164893833 TCACCATGCCCCGCTAAGGTGGG + Intronic
917035595 1:170744261-170744283 CCACCGCGCCTGGCCAAGACTGG + Intergenic
919069562 1:192736556-192736578 CCACCATGCCTGGCTGAGACTGG + Intergenic
919104188 1:193128590-193128612 CCACCATGCCTGGCCTAGGCTGG + Intronic
919876810 1:201875300-201875322 CCACCATGCCTGGCTATAAATGG - Intronic
919932639 1:202231261-202231283 TGACCATGCCTGGCTGAGCCTGG + Intronic
920005686 1:202832225-202832247 CCACCATGCCTGGCTGCTACTGG - Intergenic
920188570 1:204177876-204177898 TCACCCTTGCTGGCTATGACAGG - Intergenic
920245094 1:204581948-204581970 GCACCATGCTTGTCAAAGACAGG - Intergenic
920537462 1:206747907-206747929 CCACCATGCCTGGCCTAAACTGG + Intergenic
921235005 1:213117733-213117755 CCACCATGCCTGGCCAAGTAAGG - Intronic
921472966 1:215569705-215569727 TCACAGTGCCAGGCTGAGACAGG - Intronic
921620714 1:217323487-217323509 CCACCGTGCCTGGCCAAGTCAGG - Intergenic
921633717 1:217466510-217466532 CCACCATGCCTGGCTAAAAATGG + Intronic
921711530 1:218378126-218378148 TCACTATGCCTGGCTAATTTTGG + Intronic
921870848 1:220138183-220138205 CCACCATGCCTGGCCAACACAGG - Intronic
922161292 1:223080673-223080695 GCTCCATGCCTGGCTCACACAGG + Intergenic
922290625 1:224206355-224206377 CCACCATGCCTGGCTAATTCTGG + Intergenic
923404754 1:233648852-233648874 CCACCATGCCTGGCCAACAAAGG + Intronic
923708316 1:236363876-236363898 CCACTAAGCCTGGCCAAGACTGG - Intronic
924320530 1:242843991-242844013 CCACCATGCCTGGCTAATTTTGG + Intergenic
924546715 1:245034446-245034468 CCACCATGCCTGGCTAATTTTGG - Intronic
1063030529 10:2229838-2229860 CCACCATACCTGGCTAATTCAGG + Intergenic
1063657219 10:8003756-8003778 CCACTGTGCCTGGCCAAGACTGG - Intronic
1064050131 10:12052784-12052806 CCACCGTGCCTGGCCAAGAAAGG + Intergenic
1064269532 10:13852394-13852416 CCACCATGCCTGGTAGAGACAGG + Intronic
1064642281 10:17426947-17426969 CCACCATGCCTGGCTAATTTTGG - Intronic
1064790142 10:18949830-18949852 CCACCATGCCTGGCCAAAACAGG + Intergenic
1065278354 10:24109116-24109138 CTACCGTGCCTGGCCAAGACTGG + Intronic
1065278671 10:24112871-24112893 CCACCACGCCTGGCCATGACTGG + Intronic
1065349986 10:24786762-24786784 ACACCATGCCTGGCCAAGGCAGG + Intergenic
1065655036 10:27939583-27939605 CCACCATGCCTGGCTAATGTAGG - Intronic
1065722806 10:28642859-28642881 TCACCACACCTGGCTAATATTGG - Intergenic
1065831486 10:29618518-29618540 CCACCATGCCTGGCCCAGCCTGG + Intronic
1066085032 10:31967994-31968016 CCACCATGCCCGGCTGAGGCTGG - Intergenic
1066253592 10:33656940-33656962 CCACCATGCCTGGCTGAGATTGG + Intergenic
1066361578 10:34736962-34736984 CCACCATGCCTGGCCAAAATAGG + Intronic
1066384283 10:34929017-34929039 CCACCATGCCTGGCCCATACTGG + Intergenic
1066570149 10:36762568-36762590 CCACCATGCCCGGCCTAGACTGG + Intergenic
1067014150 10:42743508-42743530 CCACCATGCCTGGCCAAAAATGG + Intergenic
1067096936 10:43307606-43307628 CCACCATGCCTGGCCAAAACTGG - Intergenic
1067813003 10:49445298-49445320 TCACCATTCCTGGCAAATGCGGG + Intergenic
1068917879 10:62452273-62452295 TGACCATGCCTGGCCATCACTGG - Intronic
1069483023 10:68801032-68801054 CCACCATGCCTGGCTAATTTTGG - Intergenic
1070096830 10:73345650-73345672 CCACCATGCCTGGCTAATTTTGG - Intronic
1070105550 10:73427549-73427571 TCATCATGCCCGGCTAATACAGG + Intronic
1070453390 10:76584649-76584671 TCACCACGCCTGGCTAATTTGGG - Intergenic
1070722901 10:78769046-78769068 TCACCACCCCTGGCTAGGACTGG + Intergenic
1070912239 10:80128688-80128710 CCACCATGCCTGGCCAATAATGG + Intergenic
1073483487 10:103801854-103801876 CCACCATGCCTGGCTAATTTTGG + Intronic
1073543979 10:104333919-104333941 GCACCGTGCCTGGCGCAGACTGG - Intronic
1074553957 10:114471180-114471202 TCACCATGTCTGGCAGAGTCTGG + Intronic
1075113116 10:119603980-119604002 CCACCATGCCTGGCCTAGACTGG + Intergenic
1075356851 10:121786514-121786536 TCACCATGCCTGGCTAATTTTGG - Intronic
1075368200 10:121912031-121912053 CCACCATGCCCGGCCAAGCCCGG + Intronic
1075473092 10:122708279-122708301 TCTTCATGCCAGGCTAATACAGG - Intergenic
1075577198 10:123585934-123585956 TCCCCATGCCTGGAAAAGTCCGG + Intergenic
1076660412 10:132052070-132052092 CCACCATGCCTGGCTAATTGTGG - Intergenic
1076711930 10:132341141-132341163 CCACCATGCCTGGCTAATGTTGG - Intronic
1076774493 10:132687229-132687251 CCACCAAGCCTGGCCAACACTGG + Intronic
1078506421 11:11951861-11951883 TCACTGTGCCTGGGTAAGTCAGG + Intronic
1079986616 11:27206792-27206814 CCACCATGCCCGGCTAAGGCTGG + Intergenic
1080505271 11:32906549-32906571 CCACCATGCCTGGCTAAATTCGG + Intronic
1080518442 11:33045065-33045087 CCACCATGCCTGGCCAATCCTGG - Intronic
1081057998 11:38434806-38434828 CCACCATGCCTGGCTAATTTTGG + Intergenic
1081883994 11:46479044-46479066 CCACCATGCCTGGCTAATTTTGG - Intronic
1082973104 11:59043990-59044012 ACACCATGCCTGGCCATGAGAGG - Intergenic
1083144225 11:60746697-60746719 TCAGCATGCCTTGCTTAGTCTGG + Intergenic
1083224232 11:61274490-61274512 CCACCATACCTGGCAAACACAGG + Exonic
1083353322 11:62046882-62046904 TCACCATGCACCACTAAGACAGG + Intergenic
1083409221 11:62480372-62480394 TCACTGTGCCTGGCAAAGTCAGG - Intronic
1083449158 11:62731039-62731061 CCACCATGCCTGGCTAATTTTGG + Intronic
1083479255 11:62933341-62933363 TCACCAAGACTCGCTAATACAGG - Intergenic
1083582490 11:63833765-63833787 CCACCATGCCTAGCTAACAGGGG + Intergenic
1083641142 11:64146055-64146077 CCACCGTGCCTGGCCAAGAATGG + Intronic
1083696291 11:64444910-64444932 CCACCTTGCCTGGCTAAATCTGG + Intergenic
1084073800 11:66756483-66756505 CCACCATGCCTGGCTAATTATGG + Exonic
1084276886 11:68056719-68056741 CCACCATGCCTAGCTAACAAAGG - Intronic
1084635776 11:70391527-70391549 CCACCACGCCTGGCTATGGCCGG + Intergenic
1084726858 11:70947506-70947528 CCACCATGCCTGGCTAATCCTGG + Intronic
1084984087 11:72852174-72852196 CCATCATGCCTGGCTGAGAATGG + Intronic
1085114780 11:73921145-73921167 CCACCATGCCTAGCTAATATTGG - Intronic
1085125458 11:73999080-73999102 TCACCATGCCTGGCTAAAAAGGG + Intergenic
1085186454 11:74579943-74579965 GCACCCTGCTTGGCTAAAACTGG - Intronic
1085542369 11:77284006-77284028 CCACCATGCCTGGCTAATTTTGG + Intronic
1085559971 11:77462677-77462699 GCACCATGCCTGGCTAATTTTGG - Intronic
1086965120 11:93019405-93019427 CCACCATGCCTGGCCAATATAGG + Intergenic
1087043462 11:93824058-93824080 CCACCATGCCTGGCTAATTTTGG + Intronic
1087327347 11:96740009-96740031 CCACCATGCCCAGCTAAGGCTGG - Intergenic
1087789613 11:102392390-102392412 CCACCACGCCTGGCTAAGTTTGG + Intergenic
1087803063 11:102525165-102525187 CCACCATGCCTGGCCTGGACTGG - Intronic
1087985778 11:104677570-104677592 CCACCATGCCTGGCTAATGTTGG - Intergenic
1088456552 11:110038853-110038875 CCACCATGCCTGGCCAAGAAAGG - Intergenic
1088680674 11:112239030-112239052 CCACCATGCCTGGCTAATTTTGG - Intronic
1089063943 11:115647889-115647911 CCACCATCCCTGGCTAAGTTTGG + Intergenic
1089122726 11:116148957-116148979 CCACCACACCTGGCTAAGAAAGG + Intergenic
1089430439 11:118419600-118419622 CCACCATGCCTGGCTAATTTTGG - Intronic
1089723083 11:120447663-120447685 CCACCATGCCTGGCTAATTTTGG - Intronic
1090059558 11:123452356-123452378 CCACCATGCCTGGCCAAGGAAGG - Intergenic
1090739647 11:129645851-129645873 TCACCATGCCCAGCTGAGGCAGG + Intergenic
1091083006 11:132690225-132690247 TCACCATGCCTGGCCAAGCCAGG + Intronic
1091425139 12:381279-381301 CCACCGTGCCCGGCTGAGACAGG + Intronic
1091552683 12:1548737-1548759 CCACCATGCCCGGCTGAGACTGG - Intronic
1091751910 12:3027712-3027734 CCACCATGCCTGGCTAATTTTGG - Intronic
1092425483 12:8372166-8372188 CCACCATGCCTGGCTAATTTTGG + Intergenic
1092692553 12:11129996-11130018 ACACCATGCCTGGCTAATTTTGG - Intronic
1093191476 12:16079852-16079874 CCACCATGCCTGGCTAAATTTGG + Intergenic
1093371231 12:18367839-18367861 CCACCACCCCTGGCTGAGACTGG + Intronic
1093474830 12:19543417-19543439 CCACCATGCCTGGCTAATTTTGG + Intronic
1093625173 12:21337925-21337947 TCACCATGCAAAGCAAAGACTGG + Intronic
1094203403 12:27816102-27816124 CCACCATACCTGGCTAAGAAAGG + Intergenic
1096070669 12:48773865-48773887 TCACCAGGCCTGGCACAGAAGGG + Intronic
1096800143 12:54105196-54105218 CCACCACACCTGGCTAACACCGG - Intergenic
1097034247 12:56112239-56112261 CCACCATGCCTGGCTCAAAATGG + Intronic
1099058694 12:77878376-77878398 CCACCATGCCTGGCTAATTTTGG + Intronic
1099977024 12:89556773-89556795 CCACCAGGCCTGGCTAATTCTGG + Intergenic
1100438234 12:94591601-94591623 CCACCATGCCTGGCTAATTTTGG - Intronic
1100612468 12:96202812-96202834 CCACCATGCCTGGCCACCACAGG + Intronic
1101172315 12:102110687-102110709 TCATCATGCCTGGCTAATTTTGG - Intronic
1101387205 12:104268370-104268392 CCACCATGCCCGGCTAATATGGG - Intronic
1102087269 12:110152876-110152898 CCACCATGCCTGGCTTATTCGGG + Intronic
1102103289 12:110298430-110298452 CCACCACGCCTGGCCAAAACAGG - Intronic
1102362393 12:112299468-112299490 CCACCATGCCTGGCTAATTTTGG - Intronic
1102575585 12:113854242-113854264 ACACCATCCCTGCCAAAGACGGG + Intronic
1102662020 12:114537400-114537422 CCACCTTGCCTGGCCAACACTGG + Intergenic
1102746027 12:115249923-115249945 TCTCCAAGCTTGGCTAAGAGGGG - Intergenic
1103006851 12:117427948-117427970 TCACCATGCCCGGCTAACATGGG - Intronic
1103262995 12:119604918-119604940 ACACCATGCCTGGCTAAGTTAGG + Intronic
1103362167 12:120360940-120360962 CCACCAAGCCTGGCTATGAGAGG + Intronic
1104513695 12:129404482-129404504 CCACCATGCCCGGCCAAGACTGG + Intronic
1104849508 12:131864894-131864916 CCACCACGCCTGGCTAATACGGG - Intergenic
1105031792 12:132889132-132889154 TCATCATGTCCAGCTAAGACGGG - Intronic
1105491769 13:20895023-20895045 CCACCATGCCTGGCTAATTTTGG - Intronic
1105558775 13:21471147-21471169 TCACCATGTCTGGCCAAAAAAGG + Intergenic
1106254830 13:28012645-28012667 CCACCACGCCTGGCTAAGAGAGG - Intronic
1106271617 13:28159733-28159755 TCACCACACCTGGCCAATACTGG + Intronic
1106377589 13:29204243-29204265 CCACCATGCCCGGCCATGACTGG + Intronic
1106781126 13:33060114-33060136 CCACCATGCCGGGCCAAGACGGG + Intronic
1107366594 13:39685458-39685480 TTACCAAGCCTGGCAAACACTGG - Intronic
1107463453 13:40627678-40627700 CCACCATGCCTGGCTAATTTTGG - Intronic
1108197185 13:48006912-48006934 CCACCATGCCTGGCTGGGATTGG - Intergenic
1108554351 13:51578472-51578494 CCACCATGCCTGGCTAATTTTGG - Intergenic
1108650217 13:52470870-52470892 CCACCATGCCCGGCCAGGACTGG - Intronic
1109273542 13:60280100-60280122 ACACCATGCCTGGCTAATTTTGG - Intergenic
1109347145 13:61127359-61127381 CCACCATGCCTGGCCAAATCAGG + Intergenic
1109564603 13:64095678-64095700 CCACCATGCCTGGCTAATTTTGG - Intergenic
1110370759 13:74737666-74737688 CCACCATACCTGGCCATGACTGG - Intergenic
1111968554 13:94885941-94885963 CCACCAAGCCTGGCCTAGACTGG + Intergenic
1112356749 13:98679851-98679873 CCACCATGCCTGGCTAATTTTGG - Intergenic
1113339455 13:109407963-109407985 CCACCATGCCCGGCTAAGGTAGG + Intergenic
1113926716 13:113945851-113945873 TCACATGGCCTGGATAAGACTGG - Intergenic
1114300906 14:21376918-21376940 CTACCATGCCTGGCTAATCCAGG - Intronic
1114610798 14:24038952-24038974 TCACCTTGCCTGGCCTAGGCTGG + Intergenic
1115058928 14:29167773-29167795 CCACCATGCCTGTCCAAGGCTGG - Intergenic
1115234946 14:31200356-31200378 CCACCGTGCCTGGCCAAGAAAGG - Intronic
1116446448 14:45017594-45017616 CCACCACGCCTGGCCAAGAATGG - Intronic
1117375359 14:55113946-55113968 CCACCATGCCTGGCTAAAGCTGG + Intergenic
1117651663 14:57914274-57914296 CCACCATGCCCGGCTGAGACTGG - Intronic
1117685778 14:58251436-58251458 CCACCATGCCTGGCTAAGCCAGG + Intronic
1117986290 14:61389195-61389217 CCATCATGCCTGGCTTAGAGAGG - Intronic
1118212316 14:63776886-63776908 TCACCATGCCCAGCCAAAACTGG + Intergenic
1118658804 14:67984222-67984244 CCACCATGCCTGGCCAGGGCTGG + Intronic
1118853916 14:69606475-69606497 TCACCAAGCCTGGCTCTCACAGG + Intergenic
1119750742 14:77075706-77075728 CCACCAAGCCTGGCTGAGATGGG + Intergenic
1120253392 14:82088421-82088443 CCACTATGCCTGGCTGAGACTGG + Intergenic
1120516836 14:85481037-85481059 TCAGCCTTTCTGGCTAAGACGGG - Intergenic
1121349343 14:93161093-93161115 CCACCATGCCTGGCTAATTTTGG - Intergenic
1121540887 14:94725545-94725567 CCACCATGCCTGGCTAATTTTGG + Intergenic
1122497200 14:102166150-102166172 CCACCACGCCTGGCAGAGACCGG + Intronic
1123117653 14:105901901-105901923 TCCCTAGCCCTGGCTAAGACAGG - Intergenic
1123897794 15:24845885-24845907 TCACCATGCCTTGGTCAGGCTGG - Intronic
1123957536 15:25353734-25353756 TCCCCATCCCCTGCTAAGACTGG - Intronic
1124176204 15:27426525-27426547 ACACCACGCCTGGCCAAGAAAGG - Intronic
1125133271 15:36309921-36309943 CCACCATGCCTGGCTAATCTTGG + Intergenic
1125630846 15:41145801-41145823 CCACCATGCCTGGCCGAGCCTGG - Intergenic
1125822378 15:42643347-42643369 CCACCATGCCTGGCTAATTTTGG + Intronic
1125857322 15:42962775-42962797 CCACCACGCCTGGCCAACACTGG + Intronic
1126165961 15:45653967-45653989 CCACCATGCCTGGCTAATTTTGG - Intronic
1126429218 15:48562765-48562787 TCTCCTTGCCTGGTTTAGACTGG - Intronic
1126527837 15:49677440-49677462 CCACCATGCCTGGCTTGAACTGG + Intergenic
1127822097 15:62667251-62667273 CCACCGTGCCTGGCGAACACTGG + Intronic
1127875393 15:63107292-63107314 TCATCACGCCCGGCTAAGATGGG + Intergenic
1128270453 15:66304746-66304768 CCACCATGCCTGGCTAATTTTGG - Intronic
1128754856 15:70174906-70174928 CCACCATGCCTGGCTAATTTTGG + Intergenic
1129028218 15:72598971-72598993 CCACCATGCCTGGTTAGGAATGG + Exonic
1129239733 15:74244323-74244345 TCACCAGGGCTGGGGAAGACAGG + Intronic
1129526589 15:76220351-76220373 TCACCATGCCTGGCTGGCAATGG + Intronic
1129785955 15:78310246-78310268 CCACCGTGCCTGGCCAAGACTGG + Intergenic
1129808572 15:78486450-78486472 TCACCACGCCTGGCTAATTTTGG - Intronic
1129928507 15:79387078-79387100 CCACCATGCCTGGCTAATTATGG + Intronic
1131199066 15:90381093-90381115 CCACTGTGCCTGGCTGAGACTGG + Intergenic
1131240983 15:90743147-90743169 CCACCATGCCTGGCTAAAGATGG + Intronic
1131253262 15:90844846-90844868 CCACCACGCCTGGCTAAAACTGG + Intergenic
1132233756 15:100203744-100203766 CCACCATGCCTGGCTAATTTGGG - Intronic
1132417588 15:101634144-101634166 TCCCCATGCCTGGCCCAGACTGG - Intronic
1132489285 16:216845-216867 CCACCACGCCTGGCTAACTCTGG + Intronic
1132491166 16:232167-232189 CCACCGTGCCTGGCCAAGACAGG - Intergenic
1132753466 16:1470282-1470304 CCACCATGCCTGGCTCAAAATGG + Intronic
1133408312 16:5545127-5545149 CCACCATGCCTGGCTAATTTTGG + Intergenic
1133419611 16:5634981-5635003 TCACCATGATTGGTCAAGACTGG + Intergenic
1133513086 16:6479760-6479782 CCACCGTGCCTGGCCTAGACTGG - Intronic
1133558778 16:6930560-6930582 CCACCATGCCTGGCTAATTTTGG + Intronic
1133753716 16:8745542-8745564 CCACCATGCCTGGCTAATTTTGG - Intronic
1133855915 16:9549099-9549121 CCACCATGCCTGGCCAAGAATGG + Intergenic
1133870100 16:9677942-9677964 CCACCATGCCTGGCTAATTTTGG - Intergenic
1134087252 16:11366046-11366068 CCACCATGCCTGGCTCAGCATGG + Intronic
1134180763 16:12045909-12045931 CCACCGTGCCTGGCCAAGGCAGG + Intronic
1134242253 16:12514575-12514597 CCACCATGTCTGGCCAAGAGAGG - Intronic
1134391145 16:13821304-13821326 CCACCATGCCTGGCTAATTTTGG + Intergenic
1134766488 16:16763279-16763301 CCACCATGCCTGGCCAAAAAAGG + Intergenic
1135062079 16:19279603-19279625 CCACCATGCCTGGCTAATTTTGG + Intergenic
1135094448 16:19553756-19553778 CCACCATGCCTGGCTAATATCGG - Intergenic
1135295874 16:21278622-21278644 TCACCGTGCCTGGGAAAGAATGG + Intronic
1135307511 16:21379672-21379694 CCACCGTGCCTGGCCAAGGCAGG + Intergenic
1135566373 16:23514257-23514279 CCACCATGCCTGGCTAATTTTGG + Intronic
1135667878 16:24351281-24351303 CCACCATGCCTGGCTGAAACTGG - Intronic
1136155353 16:28378471-28378493 TCACCATGCCTGGTCTAGATTGG - Intergenic
1136207730 16:28736817-28736839 TCACCATGCCTGGTCTAGATTGG + Intergenic
1136304256 16:29358792-29358814 CCACCGTGCCTGGCCAAGGCAGG + Intergenic
1136473678 16:30498609-30498631 CCACCATGCCTGGCCAATAATGG - Intronic
1137266624 16:46874268-46874290 ACACCATGCCTGGCTAATTTTGG - Intergenic
1137625088 16:49902671-49902693 CCACCATGCCTGGCCAACAATGG - Intergenic
1137630182 16:49937775-49937797 CCACCATGCCTGGCCAATCCAGG + Intergenic
1137664003 16:50237607-50237629 CCACCACACCTGGCTAAGACAGG - Intergenic
1137841981 16:51649322-51649344 CCACCATGCCTGGCTAATTTTGG + Intergenic
1138061093 16:53891141-53891163 CCACCATGCCTGGCTAATTTTGG + Intronic
1138444789 16:57056809-57056831 CCACCATGCCTGGCTAATTTTGG + Intronic
1138525974 16:57607431-57607453 CCACCATGCCTGGCCAGCACTGG - Intergenic
1138698122 16:58834614-58834636 TCACCATGCCTGGCTAATTTTGG - Intergenic
1138727924 16:59161284-59161306 CCACCATGCCTGGCTAATTTTGG + Intergenic
1138754420 16:59465895-59465917 CCACCATGCCTGGCCACAACAGG + Intergenic
1138973426 16:62173696-62173718 CCACCATGCCTGACTTAGAAAGG + Intergenic
1139398800 16:66663351-66663373 CCACCATGCCTGGCTAATCTTGG - Intronic
1139460885 16:67121487-67121509 CCACCGTGCCTGGCCAAGAGTGG + Intronic
1139828259 16:69774815-69774837 CCACCATGCCTGGCTAATTTTGG - Intronic
1139833232 16:69817809-69817831 TCACCATGCTTGGCTAATTTTGG + Intronic
1140013417 16:71158976-71158998 CCACCATGCCAGGCCAAGATGGG + Intronic
1140198615 16:72876570-72876592 TCAACATGCCTGGGTAGAACAGG - Intronic
1140345383 16:74208314-74208336 CCACCACGCCAGGCTATGACAGG - Intergenic
1140757212 16:78078505-78078527 GCACCATGCCTGGCTAATCCAGG - Intergenic
1142360997 16:89626828-89626850 CCACCGCGCCTGGCCAAGACTGG - Intronic
1142571025 17:874300-874322 CCACCGTGCCCGGCTGAGACTGG - Intronic
1142966625 17:3585783-3585805 TCACCATGGCTGCCTACTACAGG - Exonic
1143025419 17:3938822-3938844 CCACCGTGCCCGGCCAAGACTGG + Intronic
1143580037 17:7820094-7820116 CCACCACGCCTGGCAAAAACTGG + Intronic
1143684500 17:8503339-8503361 GAACCATGCCTGGCTCAGATGGG + Intronic
1144126302 17:12206021-12206043 TCACCACGCCTGGCTAATTTTGG + Intergenic
1144547043 17:16206671-16206693 TCACCATGCCTGGCAAATTATGG + Intronic
1144664753 17:17094761-17094783 CCACCATGCCTGGCTAATTTTGG + Intronic
1145020668 17:19428108-19428130 CCACCATGCCTGGCTAATTTTGG + Intergenic
1145020772 17:19429065-19429087 CCACCATGCCTGGCTAATTTTGG + Intergenic
1145082763 17:19908790-19908812 CCACCACACCCGGCTAAGACAGG + Intronic
1145092297 17:19995902-19995924 TCACCACGCCTGGCCAACTCTGG + Intergenic
1145868189 17:28254023-28254045 CCACCATGCCTGGCCAGGAGCGG - Intergenic
1146467246 17:33095918-33095940 TCCCCATGCCTGGGTGACACAGG - Intronic
1146975033 17:37103887-37103909 TCACCATGCCTGGCTAATTTTGG - Intronic
1147003001 17:37378423-37378445 CCACCATGCCTGGCCAAAGCTGG - Intronic
1147263330 17:39221384-39221406 CCACCGCGCCTGGCCAAGACTGG + Intronic
1147271899 17:39278990-39279012 CCACCATGCCTGGCTAATTTTGG - Intronic
1147404559 17:40201610-40201632 CCACCATGCCTGGCCAGGAAGGG - Intergenic
1147682064 17:42255933-42255955 CCACCATGCCTGGCTAATTTTGG - Intronic
1147778410 17:42920703-42920725 CCACCATGCCTGGCTAATTTTGG + Intergenic
1147870860 17:43586516-43586538 CCACCATGCCTGGCCTAGGCAGG - Intergenic
1147983444 17:44289557-44289579 ACACCATGCCTGGCTAAGACAGG + Intergenic
1148096318 17:45054786-45054808 TAATCATGGCTGGCCAAGACAGG + Intronic
1148925910 17:51085001-51085023 CCACCATGCCTGGCTAATTTTGG + Intronic
1149779413 17:59385423-59385445 CCACCATGCCTGGCTAATTTTGG - Intronic
1150111587 17:62504994-62505016 CCACCATGCCTGGCTAATTTTGG + Intronic
1150505297 17:65692512-65692534 TCACCACGCCTGGCCTGGACTGG + Intronic
1150688473 17:67341314-67341336 CCACCATGCCTGGCTAATTTTGG - Intronic
1150701614 17:67451921-67451943 CCACCACGCCTGGCCGAGACTGG + Intronic
1151584533 17:75001079-75001101 CCACCATGCCTGGCTAATTTTGG - Intronic
1152510626 17:80784849-80784871 CCACCACGCCTGGCTAATGCTGG + Intronic
1152763282 17:82121096-82121118 CCACCATGCCTGGCAACGGCTGG - Intronic
1153060359 18:988817-988839 CCACCATGCCTGGCTAATTTTGG + Intergenic
1153198492 18:2626109-2626131 CCACCATGCCTGGCTAATTTGGG + Intergenic
1153543901 18:6186327-6186349 CCACCATGCCTGGCCAAAAAGGG + Intronic
1154308474 18:13248111-13248133 CCACCATGCCTGGCTAATTTTGG + Intronic
1154384611 18:13881486-13881508 CTCCCATGCCTGGCCAAGACAGG + Intergenic
1154932055 18:21009298-21009320 TCACCGCGCCTGGCCAAGACAGG + Intronic
1155109974 18:22705056-22705078 TCCACATGCGTGGCTGAGACAGG - Intergenic
1155176125 18:23302758-23302780 CCACCCTGGCTGGCTGAGACTGG - Intronic
1155306014 18:24479068-24479090 CCACCATGCCTGGCTAATTTTGG + Exonic
1155852716 18:30792804-30792826 ACACCATGCCTGGCCATGAATGG - Intergenic
1156120008 18:33831914-33831936 CCACCGTGCCTGGCCCAGACAGG - Intergenic
1156261596 18:35449408-35449430 CCACCATGCCTGGCTAATTTTGG - Intronic
1156463969 18:37337019-37337041 TCACCATGCCTGGCGCTCACAGG + Intronic
1156505704 18:37590231-37590253 CCACCATGCCTGGCCAACTCTGG + Intergenic
1157023506 18:43815367-43815389 CCACCACGCCGGGCCAAGACAGG - Intergenic
1157253428 18:46116406-46116428 CCACCATGCCTGGCTAATTTTGG - Intronic
1157996087 18:52557810-52557832 CCACCATGCCTGGCTAATTTTGG + Intronic
1158231711 18:55263487-55263509 CCACTATGCCTGGCTAAGGCAGG + Intronic
1158625926 18:59071656-59071678 CCACCATGCCTGGCTAATTTTGG + Intergenic
1158881477 18:61783330-61783352 CCACCATGCCCGGCCATGACTGG + Intergenic
1158927658 18:62285466-62285488 GCACCATGCCTGACTTAGACAGG - Intronic
1159367081 18:67482039-67482061 GCACCATGCCTCTCTGAGACTGG + Intergenic
1160205313 18:76826644-76826666 CCACCATGCCTGGCTAACTTTGG - Intronic
1160753155 19:744604-744626 CCACCATGCCTGGCCATTACAGG - Intronic
1160842711 19:1153688-1153710 CCACCACGCCTGGCTAAGTTTGG + Intronic
1161157683 19:2741502-2741524 CCACCATGCCTGGCTAATTTTGG - Intergenic
1161160674 19:2760363-2760385 CCACCATGCCTGGCTAATTTTGG - Intronic
1161178715 19:2864995-2865017 CCACCATGCCTGGCCAACGCTGG - Intergenic
1161538826 19:4837142-4837164 CCACCACGCCCGGCTAAGGCTGG - Intergenic
1161626742 19:5331418-5331440 CCACCATGCCTGGCAAAATCAGG + Intronic
1161645259 19:5449443-5449465 CCACCATGCCTGGCCAAGACAGG + Intergenic
1162039943 19:7964545-7964567 CCACCATGCCTGGCCCAGAAAGG - Intronic
1162065687 19:8123935-8123957 TCACCCTGCCTGGCAAGTACCGG - Exonic
1162154657 19:8669230-8669252 CCACCAAGCCTGGCCAAGAGAGG + Intergenic
1162274782 19:9644485-9644507 CCACCGTGCCTGGCCGAGACTGG + Intronic
1162356225 19:10186683-10186705 CCACCATGCCTGGCTGATTCTGG - Intronic
1162485352 19:10956968-10956990 CCACCGTGCCTGGTTGAGACAGG + Intergenic
1162925216 19:13927489-13927511 CCACCATGCCTGGCCAAGAGTGG - Intronic
1162986185 19:14271714-14271736 CCACCATGCCCGGCCAAGACAGG + Intergenic
1163161635 19:15468376-15468398 CCACCGTGCCTGGCTATGCCTGG + Intergenic
1163268890 19:16237578-16237600 CCACCATGCCTGGCTAATTTTGG - Intronic
1163345139 19:16736380-16736402 CCACCATGCTTGGCTTTGACTGG + Intronic
1163869834 19:19811310-19811332 TCACCATGCCTGGCTAATTTTGG + Intronic
1164924054 19:32112809-32112831 CCACCATGCCTGGCTAACACTGG + Intergenic
1164947304 19:32307060-32307082 CCACCGTGCCTGGCCCAGACTGG + Intergenic
1166392267 19:42415521-42415543 CCACCATGCCCAGCTAAGACTGG - Intronic
1166515707 19:43445217-43445239 TCACCATGCCTGGCCAATAATGG - Intergenic
1166537949 19:43587175-43587197 CCACCATGCCTGGCTAATTTTGG - Exonic
1166706996 19:44913595-44913617 CCACCATGCCTGGCTAATGCAGG + Intergenic
1166709167 19:44926155-44926177 CCACCATGCCTGGCCAATGCAGG + Intergenic
1166916265 19:46197817-46197839 TCACTGTGCCTGGCCAGGACAGG + Intergenic
1167003662 19:46761121-46761143 TCACCATACTTGGCCAATACTGG - Intronic
1167326190 19:48827328-48827350 CCACCGTGCCTGGCAAGGACAGG + Intronic
1167474974 19:49694851-49694873 CCACCATGCCTGGCCAAGGATGG - Intronic
1167871566 19:52375022-52375044 CCACCATGCCTGGCCTAGAAGGG + Intronic
1168235096 19:55057934-55057956 CCAGCATGCCTGGCTAACTCTGG + Intronic
1168357435 19:55710796-55710818 CCACCATGCCTGGCAGAGACTGG - Intronic
1168713633 19:58515035-58515057 CCACCACGCCTGGCTGAGACAGG - Intronic
1168723276 19:58566684-58566706 TCACCACACCTGGCTCAGAGAGG - Intronic
924964452 2:62393-62415 CCACCATGCCTGGCCCAGAGTGG - Intergenic
925349305 2:3189878-3189900 TCACCGTGTCTGGGTAACACAGG + Intronic
925819917 2:7790153-7790175 CCACCATGCCTGGCCCAGATTGG - Intergenic
925923584 2:8654546-8654568 CCACCATGCCTGGCCATGATGGG - Intergenic
925923591 2:8654579-8654601 CCACCATGCCTGGCCATGATGGG - Intergenic
926261995 2:11272715-11272737 TCACCGTGCCTGGCTAATTTTGG - Intronic
927876783 2:26662005-26662027 CCACCATGCCCGGCCAAGACAGG + Intergenic
928055700 2:28051935-28051957 CCACCATGCCTGGCCAAGTCAGG + Intronic
928340496 2:30439317-30439339 CCACCATGCCTGGCTGAGACTGG + Intergenic
928563486 2:32517186-32517208 TCACCATGCCCGGCTAATTTTGG - Intronic
929207537 2:39314180-39314202 TCAACATGCCTGGCTAATTTTGG + Intronic
929236519 2:39610824-39610846 CCACCATGCCTGGCTAATTTTGG + Intergenic
930110101 2:47671579-47671601 CCACCATGCCTGGCCAATATAGG + Intergenic
930116317 2:47721464-47721486 CCACCATGCCTGGCTAATTATGG + Intronic
930333944 2:50022001-50022023 CCACCATGCCTGGCTAATTTTGG + Intronic
930377565 2:50587195-50587217 CCACCATGCCTGGCCAAAACAGG - Intronic
930377809 2:50589639-50589661 CCACCATGCCTGGCCAAAACAGG + Intronic
930774646 2:55160039-55160061 TCACCACACCTGGCTAAGCCTGG + Intergenic
931283138 2:60810896-60810918 CCACCATGCCTGGCCGAGACAGG - Intergenic
931338300 2:61372556-61372578 CCACCATGCCTGGCGGAAACAGG - Intronic
932107176 2:68954756-68954778 TCTCCTTGCCTTGCTGAGACAGG + Intergenic
932282121 2:70502490-70502512 TCACCATGCCTGGCTAAGACGGG + Intronic
933429421 2:82156477-82156499 CCACCACGCCTGGCCAAGAATGG + Intergenic
933722528 2:85407423-85407445 CCACCATGCCTGGCTGGCACTGG - Intronic
933874037 2:86600672-86600694 CCACCGTGCCTGGCTAAGATGGG - Intronic
934054044 2:88236812-88236834 TCACTCTGCCTGGCTAATCCAGG - Intergenic
934076409 2:88432252-88432274 CCACCACGCCCGGCTGAGACAGG - Intergenic
934723666 2:96601113-96601135 CCACCATGCCCGGCTACAACAGG - Intronic
934724047 2:96603569-96603591 TCACCATGCCTGGCCAGGAGAGG + Intronic
935201556 2:100861152-100861174 CCACCATGCCTGGCCCAGCCTGG + Intronic
935804223 2:106730199-106730221 TCACCCTGCCTCTCTAACACCGG + Intergenic
935821518 2:106897500-106897522 CCACCATGCCTGGCTAGGTTTGG + Intergenic
936014727 2:108949267-108949289 CCACCAAGCCTGGCTAACATAGG + Intronic
937176232 2:119938412-119938434 CCACCATGCCTGGCTAATGTGGG + Intronic
937366489 2:121265769-121265791 CCACCGTGCCTGGCCAAGAGTGG + Intronic
937821997 2:126320710-126320732 CCACCATGCCTGGCCAAGTGAGG + Intergenic
937880428 2:126860259-126860281 TCACAATGCCTGGCACACACTGG + Intergenic
937960939 2:127458149-127458171 CCACCATGTCTGGCTAATATAGG - Intronic
938035810 2:128034070-128034092 CCACCATGCCTGGCCAAGATTGG - Intergenic
938721279 2:134069265-134069287 CCACCATGCCTGGCTGCCACTGG - Intergenic
938800333 2:134757174-134757196 TCACCATGCCTGGCTAATTTTGG - Intergenic
938835362 2:135097366-135097388 CCACCATGCCCGGCTAAGTTGGG + Intronic
938870971 2:135475923-135475945 TCACCATGCCTGGCTAATTTTGG - Intronic
939181255 2:138804745-138804767 CCACCATGCCTGGCTAATTTTGG - Intergenic
939392301 2:141584090-141584112 CCACCATGCCTGGCTAACGTTGG - Intronic
939918565 2:148079702-148079724 CCACCATGCCTGGCTAATTTTGG - Intronic
940229903 2:151439694-151439716 CCACCATGCCTGGCTGAGAATGG - Intronic
940785244 2:157974084-157974106 CCACCATGCCTGGCTAATTTTGG + Intronic
941113123 2:161439742-161439764 GCACCCCGCCTGGCTAAGGCTGG - Intronic
942097429 2:172547210-172547232 CCACCGCGCCTGGCCAAGACGGG + Intergenic
944082961 2:195810562-195810584 CCACCATGCCTGGCTAATTTTGG + Intronic
945092789 2:206191598-206191620 TCACCATATCTGGTTAAGAGTGG + Intronic
946270771 2:218591588-218591610 CCACCATGCCTGGCTAATTTTGG - Intronic
946768149 2:223059554-223059576 TCACCATTCCAGGCTGACACAGG - Intronic
947016981 2:225631968-225631990 CCACCATGCCTGGCTAATTTTGG + Intronic
947496686 2:230642940-230642962 TCACCCTGCTTGGCAAATACAGG + Intergenic
947557012 2:231101966-231101988 CCACCATGCCTGGCTAATTTTGG + Intronic
947997596 2:234541947-234541969 CCACCATGCCCAGCTGAGACAGG + Intergenic
948011714 2:234654100-234654122 CCACCATGACTGGCCAAGAAAGG + Intergenic
948496835 2:238356207-238356229 CCACCATGCCTGGCCAGGAATGG - Intronic
1169223263 20:3839599-3839621 CCACCATGCCTGGCCCAGCCAGG - Intergenic
1169246189 20:4027078-4027100 CCACCATGCCTGGCTAATTTTGG + Intergenic
1169438732 20:5616220-5616242 TCACCATGCCTGGCTAATTTGGG + Intergenic
1169838229 20:9904814-9904836 CCATCATGCCTGGCCAAGAGAGG - Intergenic
1170687600 20:18583547-18583569 CCACCATGCCCTGCTAAGGCAGG - Intronic
1171236019 20:23525780-23525802 CCACCACGCCTGGCTCAGCCTGG - Intergenic
1171796304 20:29569146-29569168 CCACCACACCTGGCTAACACCGG + Intergenic
1171814693 20:29775320-29775342 CCACCATGCCTGGCTAATTTTGG + Intergenic
1171945675 20:31375300-31375322 CCACCATGCCTGGCTAATTTTGG + Intergenic
1172054488 20:32144620-32144642 CCACCATGCCTGGCCAACAATGG - Intronic
1172622555 20:36329195-36329217 TCACCATACCTGGCCAAGGTTGG + Intronic
1173183192 20:40820050-40820072 CCACCATGCCTGCCTAAACCTGG + Intergenic
1173520482 20:43696391-43696413 CCACCATGCCTGGCTAATTGGGG + Intronic
1173631188 20:44516835-44516857 CCACCATGCCCAGCTAAGAGAGG + Intronic
1173738928 20:45382042-45382064 TCACCATGCCTGGCTATTTTTGG - Intronic
1174019503 20:47518710-47518732 CCACCATGCCTGGCCAATAGAGG + Intronic
1174324271 20:49766798-49766820 CCACCACACCTGGCTAATACTGG + Intergenic
1174347454 20:49940892-49940914 CCACCATGCCTGGCTAATTTTGG + Intronic
1174660298 20:52206728-52206750 CCACCATGCCCGGCCGAGACAGG + Intergenic
1174836360 20:53859289-53859311 TCACCATGCCCGGCTAATTTTGG + Intergenic
1175592862 20:60207319-60207341 CCACCATGCCTGGCCGAGACTGG + Intergenic
1175830461 20:61962569-61962591 CCACCATGCCTGGCCTAGGCGGG - Intronic
1176311501 21:5153189-5153211 TCACCTTTCCTGGGTAAGAGAGG + Intronic
1176718816 21:10377223-10377245 CCACCATGCCTGGCTAATTTTGG + Intergenic
1177221929 21:18205887-18205909 CCACCATGCCTGGCTAATTTAGG + Intronic
1177559368 21:22730231-22730253 TCACACTGCCTGCCTAACACCGG - Intergenic
1178336699 21:31749818-31749840 CCACCACGCCTGGCTAATTCTGG - Intergenic
1178361822 21:31954933-31954955 CCACCATGCCTGGCTAATTTTGG + Intronic
1178564361 21:33669368-33669390 CCACCATGCCTGGCCCAAACTGG + Intronic
1178920158 21:36733529-36733551 TCACACTGCCTGGCTAACCCAGG + Intronic
1179148213 21:38787648-38787670 TCACTGTGCCGGGCAAAGACTGG - Intergenic
1179668043 21:42925952-42925974 CCACCGTGCCCGGCTGAGACAGG - Intergenic
1179814142 21:43892940-43892962 TCACCATGCCTGGCTAATTTTGG - Intronic
1179845549 21:44108846-44108868 TCACCTTTCCTGGGTAAGAGAGG - Intronic
1180163478 21:46008301-46008323 CCACCGTGCGTGGCCAAGACTGG + Intergenic
1180217803 21:46337147-46337169 CCACCATGCCTGGCTAATTGGGG + Intronic
1180982149 22:19883664-19883686 CCATCACGCCTGGCTGAGACAGG - Intronic
1181498241 22:23300466-23300488 TGACCATGCCAGCCTCAGACTGG - Intronic
1181802964 22:25359138-25359160 CCACCATGCCTGGCCAGGCCAGG - Intronic
1182846484 22:33435287-33435309 CCACCATGCCTGGCTCCTACGGG + Intronic
1183249352 22:36718557-36718579 CCACCATGCCCGGCTAAGATGGG + Intergenic
1183399459 22:37593563-37593585 CCACCATGCCTGGCCTATACTGG + Intergenic
1183748529 22:39705961-39705983 AGACCCTGCCTGGCTCAGACAGG + Intergenic
1183837342 22:40465851-40465873 GCACTATGCCTGGCCAAGATAGG + Intronic
1183891691 22:40935086-40935108 CCACCATGCCCGGCCAAGCCCGG - Intergenic
1184028872 22:41879146-41879168 CCACCACGCCTGGCTGAGTCAGG + Intronic
1184207822 22:43016050-43016072 TCACCATGCCTGGCTCTATCTGG - Intergenic
1184229272 22:43149837-43149859 CCACCACGCCCGGCTAAGAAGGG + Intergenic
1184339345 22:43877569-43877591 TCACCATGCCTGGATAATTTTGG + Intergenic
1184597332 22:45522136-45522158 TCACCATGCGTGGCTAATTTTGG + Intronic
1184752465 22:46495661-46495683 CCACCATGCCTGGCTAAACAGGG - Intronic
1185004748 22:48269081-48269103 TCCCCAGGCCTGGCTACGGCGGG + Intergenic
1185225267 22:49648410-49648432 TGGCCATGCCTGGCTCAGAAGGG - Intronic
1185230955 22:49681855-49681877 TCAACATGCCTGATCAAGACGGG - Intergenic
949209781 3:1483703-1483725 TCACCATGCTTAGCAAAGCCTGG + Intergenic
950059188 3:10055523-10055545 TCACCGTGCCCGGCCAAGAATGG - Intronic
950486972 3:13279705-13279727 CCACCAGGCCTGGCTTAGCCTGG + Intergenic
951034630 3:17919821-17919843 ACACCATGCCCAGCCAAGACAGG - Intronic
951704957 3:25535122-25535144 TCAGCTTGCCTGGCTAATAGTGG - Intronic
951927062 3:27919821-27919843 CCACCATGCCTGGCTAATTTTGG - Intergenic
952482940 3:33780742-33780764 TCACCATGCCTAGCTAATTTTGG - Intergenic
952551808 3:34486969-34486991 CCACCATGCCTGGCCTAGAAAGG - Intergenic
953398993 3:42596172-42596194 GCACCATGCCTGGCTAATTTTGG + Intronic
953423323 3:42772117-42772139 CCACCATGCCTGGCTAATTTTGG - Intronic
954257219 3:49415227-49415249 CCACCATGCCTGGCCAACTCAGG - Exonic
954472135 3:50707206-50707228 CCACCATGCCTGGCCAAGACTGG - Intronic
955693851 3:61616237-61616259 CCACCATGCCCGGCTGAGAATGG + Intronic
956130789 3:66052060-66052082 CCACCATGCCTGGCTGAGCATGG - Intergenic
957867955 3:86049546-86049568 CCACCGTGCCTGGCCAAGACTGG + Intronic
957868660 3:86058939-86058961 TCACCATGCCAGGCTAATTTTGG - Intronic
958006887 3:87823672-87823694 CCACCATGCCCGGCCAAGGCTGG + Intergenic
959710073 3:109377047-109377069 CCACCATGCCCGGCCTAGACTGG - Intergenic
959765488 3:110022333-110022355 CCATCATGCCTGGCTAAGTTTGG - Intergenic
960453258 3:117837230-117837252 CCACCATGCCTGGCTCAATCAGG - Intergenic
960666911 3:120118314-120118336 CCACCATGCCTGGCCAAAAAGGG - Intergenic
960780076 3:121310754-121310776 CCACCATGCCTGGCTAATTTTGG - Intronic
961004461 3:123395585-123395607 CCACCATGCCTGGCTGACATGGG - Intronic
961016307 3:123470896-123470918 CCACCATGCCTGGCTAATCTTGG + Intergenic
961261274 3:125604160-125604182 CCACCATGCCTAGCTGAGATGGG + Intergenic
961739394 3:129023479-129023501 CCACCATGCCTGGCTAATTTTGG + Intronic
962801113 3:138891462-138891484 CCACCATGCCCGGCCATGACTGG - Intergenic
963210164 3:142680350-142680372 CCACCATGCCTGGCCAAAACTGG + Intronic
964124728 3:153224251-153224273 CCACCATGCCTGGCTAATTTTGG + Intergenic
964558652 3:157968468-157968490 CCACCATGCCTGGCTAAGTTTGG - Intergenic
964750131 3:160046822-160046844 CCACCATGCCTGGCCAAGTAGGG + Intergenic
965339136 3:167464299-167464321 CCACCATGCCTGGCCAGGAGTGG + Intronic
965481582 3:169225454-169225476 TCACCAGTCCTTGATAAGACAGG - Intronic
965554732 3:170007252-170007274 TCAAAATGCCTGGCTGAGAGGGG + Intergenic
966184504 3:177215863-177215885 CCACCATGCCTGGCCAGCACTGG - Intergenic
966394542 3:179488695-179488717 CCGCCATGCATGGCCAAGACAGG - Intergenic
967356695 3:188579815-188579837 CCATCATGCCTGGCTAATCCTGG - Intronic
968126216 3:196162447-196162469 CCAACATGCCTGGCTAATTCTGG - Intergenic
968214395 3:196876008-196876030 CCACCATGCCTGGCCAATATTGG + Intronic
969420622 4:7092833-7092855 CCACCATGCCTGGCTAATTTTGG + Intergenic
969633027 4:8349493-8349515 CCACCACGCCTGGCCAAGACAGG - Intergenic
970578654 4:17452689-17452711 TCATCACGCCTGGCTGAGACTGG - Intergenic
971045487 4:22801116-22801138 CCACCATGCCTGGCTAATTTTGG + Intergenic
971333463 4:25701480-25701502 CCACCATGCCCGGCCAACACAGG + Intergenic
971344106 4:25796639-25796661 CCACCATGCCTGGCTAATTTTGG - Intronic
972413166 4:38813208-38813230 TCACCATGCCTGGCTAATTTTGG - Intronic
972545305 4:40074717-40074739 GCACCATGCCCAGCCAAGACTGG - Intronic
972546852 4:40088043-40088065 CCACCACGCCCGGCTACGACTGG + Intronic
972589320 4:40469584-40469606 TCACCATGCCTGGCTAATTTTGG + Intronic
972630635 4:40838754-40838776 CCACCATGCCTGGCAAAAGCAGG + Intronic
972920584 4:43936520-43936542 CCACCATGCCCGGCCATGACTGG - Intergenic
973556208 4:52085754-52085776 CCACCATGCCTGGCTAATTTGGG - Intronic
974435049 4:61846025-61846047 CCACCATACCTGGCCAAGAAAGG - Intronic
974769266 4:66389535-66389557 CCACCATGCCAGGCTAAGATGGG + Intergenic
976258365 4:83122246-83122268 CCACCATGCCTGGCTAATTTTGG + Intronic
976902968 4:90202353-90202375 TCACCATGCCTGGCTAACTTTGG + Intronic
977822161 4:101485827-101485849 CCACCATGCCTAGCTAAGATGGG + Intronic
977939405 4:102842820-102842842 CCACCACGCCTGGCCAAAACTGG - Intronic
978177001 4:105743944-105743966 CCACCATGCCTCGCCAAAACAGG + Intronic
978714595 4:111826076-111826098 CCACCATGCCCGGCTAATAGAGG + Intergenic
978785551 4:112605446-112605468 TCACCATGCCTGGCCAAAATAGG + Intronic
978845317 4:113266588-113266610 CCACCATGCCTGGCAGAGATAGG - Intronic
980796966 4:137697643-137697665 CCACCATGCCCGGCCAAGACTGG + Intergenic
981375275 4:144007923-144007945 CCACCATGCCTGGCTTAGAATGG + Intronic
981697757 4:147575708-147575730 CCACCATGTCTGGCTGACACTGG + Intergenic
982270347 4:153579622-153579644 TCACCACGCCTGGCTAATTCTGG + Intronic
982543408 4:156704642-156704664 CCACCATGCCTGGCTAATTTGGG - Intergenic
982664610 4:158245990-158246012 CCACCATGCCTGGCTAGAAGGGG - Intronic
983169791 4:164522480-164522502 CCACCATGCCTGGCTCTGTCAGG + Intergenic
983739164 4:171106199-171106221 CCACCATGCCTGGCCAACATAGG + Intergenic
983928985 4:173432658-173432680 CCTCCATGCCTGCCTCAGACAGG - Intergenic
984585771 4:181562825-181562847 TCACCATGCCTGGCTAATTTTGG + Intergenic
984588966 4:181595276-181595298 TCACCATGCCTGGCTAATTTTGG - Intergenic
984701395 4:182820807-182820829 TCTCCATGCCTGGCATAGAGGGG + Intergenic
985616924 5:928297-928319 CCACCACGCCCGGCCAAGACTGG - Intergenic
986002658 5:3642451-3642473 TCACCAGGCCTGGCACAGGCGGG - Intergenic
986071369 5:4287931-4287953 CCACCATGCCTGGCTGAGCAAGG + Intergenic
986723492 5:10577280-10577302 CCACCATGCCTGGCTAATTTTGG + Intronic
987031627 5:13981362-13981384 GCACCGTGCCTGGCTTAGAGTGG + Intergenic
987735518 5:21838270-21838292 CCACCATGCCTGGCCAGCACTGG - Intronic
987863549 5:23513592-23513614 CCACCATGCCTGGCCCAGAGTGG - Intronic
987882644 5:23769192-23769214 CCACCATGCCCGGCCAAAACAGG + Intergenic
988462321 5:31451047-31451069 CCACCATGCCTGGCTAATTTTGG - Intronic
988476844 5:31594035-31594057 CCACCACCCCTGGCTAACACTGG - Intergenic
988598363 5:32616356-32616378 CCACCATGCCTGGCTAATTTTGG + Intergenic
988603976 5:32664711-32664733 TCACCATGCCCGGCTGAGACAGG + Intergenic
989309461 5:39997719-39997741 CCACCATGCCTGGCTAATTTTGG - Intergenic
990246996 5:53873170-53873192 CCACCATGCCTGGCTAATTTTGG + Intergenic
990471789 5:56122504-56122526 CCACCATGCCTGGCTAATTTTGG - Intronic
990570303 5:57071764-57071786 CCACCATGCCTGGCTAATTTTGG + Intergenic
990918046 5:60932335-60932357 CCACCATGACTGGATAAGAATGG + Intronic
990967130 5:61461217-61461239 TGACCTTGCCTGGCTACTACAGG - Intronic
991953572 5:71970489-71970511 CCACCATGCCTGGCTAATTTTGG + Intergenic
992042946 5:72855146-72855168 CCACCATGCCTGGCTAATTTGGG + Intronic
992212600 5:74495431-74495453 TGAGCATGCCTGGCTCAGATTGG - Intergenic
992403311 5:76431535-76431557 CCACCGTGCCCGGCCAAGACTGG - Intronic
993948938 5:94149902-94149924 CCACCATGCCTGGCTAATTTTGG + Intergenic
994145144 5:96386675-96386697 CCACCATGCCTGGCAAAGTATGG - Intergenic
995233632 5:109799799-109799821 TCACCATGCCCGGCCAAGATTGG - Intronic
995380186 5:111523106-111523128 CCACCATGCCTGGCTGAGACAGG - Intergenic
995517034 5:112964476-112964498 CCACCATGGCTGGCCAAGGCTGG - Intergenic
996547059 5:124691115-124691137 CCACCATACCTGGCTGAGACGGG - Intronic
996767484 5:127048958-127048980 TCACCCTGCCTGGAGAAGGCAGG + Intronic
997140560 5:131375949-131375971 CCACCATGCCTGGCCAAGATGGG - Intronic
997181221 5:131831260-131831282 CCACCATGCCTGGCCAAAAGAGG - Intronic
997998014 5:138602185-138602207 CCACCATGCCAGGCTGAGAGTGG + Intergenic
998153100 5:139768433-139768455 CCACCATGCCTGGCCAAGGAAGG - Intergenic
998248583 5:140532943-140532965 CCACCATGCCTGGCTAAATTCGG - Intronic
998469031 5:142368964-142368986 CCACCATGCCTGGCTAATTTTGG + Intergenic
999894883 5:156021345-156021367 TCACCATGCTTGGCTAATTAAGG - Intronic
1000892472 5:166816011-166816033 TCACCATGCCCGGCTAATTTTGG - Intergenic
1001921293 5:175602035-175602057 CCACCATGCCTGGCTACCATAGG + Intergenic
1001995104 5:176151133-176151155 CCACCATGCCTGGCTAATTTGGG + Intergenic
1002003120 5:176209676-176209698 CCACCATGCCTGGCATAGACTGG + Intergenic
1002223344 5:177701274-177701296 CCACCATGCCTGGCATAGACTGG - Intergenic
1002351073 5:178584160-178584182 TCACCATGCCTGGCTAAATTTGG + Intronic
1002392630 5:178927822-178927844 CCACCAAGCCTGGCTGAGTCTGG + Intronic
1002399005 5:178980919-178980941 CCACCATGCCTGGCCAAGGTTGG + Exonic
1003520370 6:6853529-6853551 GCACCGTGCCTAGCCAAGACAGG - Intergenic
1003637866 6:7850293-7850315 CCACCATGCCTGGCTAATTTTGG + Intronic
1004270170 6:14188216-14188238 CCACCATGCCTGGCTAAGAATGG + Intergenic
1004277752 6:14253471-14253493 TCACCATGCCTGGCAAGGTCAGG - Intergenic
1004371124 6:15053436-15053458 CCACCACGTCTGGCTAAGAATGG - Intergenic
1004392396 6:15220719-15220741 CCACCATGCCTGGCGAAGCTGGG + Intergenic
1004419536 6:15455813-15455835 TCACCATGCCCGGCGAAGCCAGG + Intronic
1004532710 6:16468474-16468496 CCACCATGCCTGGCCCGGACTGG + Intronic
1004721350 6:18270106-18270128 TCACCACGCCTGGCTAATTTTGG - Intergenic
1004729670 6:18345535-18345557 TCACCATGCCTGGCTAATTTTGG + Intergenic
1004999261 6:21224372-21224394 TCACCACGCCTGGCTAATTTTGG - Intronic
1005346744 6:24897910-24897932 CCACCATGCCTGGCTGAGGCAGG + Intronic
1006375577 6:33670009-33670031 TCACCCTCCCTGGCCAAGGCTGG + Intronic
1006451094 6:34106125-34106147 CCACCATGCCTGGCCATGATGGG - Intronic
1006681961 6:35803725-35803747 CCACCATGCCTGGCTATGCCTGG + Intergenic
1006822633 6:36910438-36910460 CCACCATGCCTGGCCAATAAAGG - Intronic
1007004712 6:38349933-38349955 TCCTCATGCTTAGCTAAGACAGG - Intronic
1007015856 6:38465981-38466003 TCATCATGCCCAGCTAAGATGGG + Intronic
1007252764 6:40507422-40507444 TCACAATGCCTTGCTGAGAGAGG + Intronic
1007339525 6:41181730-41181752 ACACCCTGCCTGGCAAAGACAGG + Intergenic
1007516040 6:42412151-42412173 CCACCATGCCTGGCTAATTTTGG + Intronic
1007757192 6:44107496-44107518 CCACCGTGCCTGGCTGAGATGGG - Intergenic
1008277253 6:49555891-49555913 CCACCATGCCTGGCCAAGTGTGG + Intronic
1008901994 6:56630933-56630955 CCACCATGCCTGGCTAACTTTGG + Intronic
1008940172 6:57038158-57038180 TCATCATGCCTGGCTAATTTTGG - Intergenic
1009953095 6:70419131-70419153 CCACCATGCCTGGCCAAAACAGG - Intronic
1010218563 6:73427586-73427608 CCACCATGCCTGGCCAATACTGG + Intronic
1011201971 6:84846688-84846710 CCACCGTGCCTGGCCAAGAAAGG - Intergenic
1011287004 6:85735570-85735592 CCACCATGCCTAGCCAATACTGG + Intergenic
1011358972 6:86501716-86501738 TAATGATGCTTGGCTAAGACAGG + Intergenic
1011778180 6:90755863-90755885 CCACCATGCCTGGCTAATTTTGG + Intergenic
1012697991 6:102413646-102413668 CCACTGTGCCTGGCCAAGACAGG + Intergenic
1013120391 6:107135600-107135622 CCACCATGCCCGGCTAAAACAGG + Intergenic
1014177984 6:118350744-118350766 CCACCACGCCTGGTTAAGCCTGG - Intergenic
1014848200 6:126306416-126306438 CCACCATGCCTGGCCAAAGCTGG - Intergenic
1014995208 6:128134656-128134678 CCACCATGCCTGGCTAATGTTGG - Intronic
1015047521 6:128794179-128794201 CCACCATGCCTGGCTCATCCCGG - Intergenic
1015177250 6:130323513-130323535 CCACCATGCCTGGCCTGGACAGG - Intronic
1015279583 6:131418913-131418935 CCACTGTGCCTGGCTGAGACTGG + Intergenic
1015344417 6:132139026-132139048 CCACCATGACTGGCCAATACGGG - Intergenic
1015990916 6:138942029-138942051 TCACCATGCCTGGCTAATTTTGG + Intronic
1016158589 6:140846151-140846173 CCACCATGCCTGGCTAATGTTGG - Intergenic
1016470837 6:144372645-144372667 CCACCATGCCTGGCTAATTTTGG + Intronic
1016832719 6:148449355-148449377 TCACCGTACCTGGCTGAGACTGG + Intronic
1016954069 6:149609515-149609537 CCACCATGCCTGGCCGAGACAGG - Intronic
1017134134 6:151133478-151133500 CCATCATGCCTGGCCAAGAGAGG - Intergenic
1017509587 6:155102147-155102169 CCACCATGCCTGGCTAATTTTGG + Intronic
1017849813 6:158295600-158295622 CCACCATGCCTGGCCAATGCTGG - Intronic
1018193062 6:161327833-161327855 CCACCATGCCTGGCTAACTTTGG + Intergenic
1018198044 6:161371924-161371946 CCACCATGCCTGGCCCAGAAGGG + Intronic
1018554072 6:165032815-165032837 CCACCATGCCTGGCTGAGGCTGG - Intergenic
1019021711 6:168924090-168924112 CCACCATGCCCGGCCAAGACAGG + Intergenic
1019766884 7:2857986-2858008 TCACCATGCCTGGCTAATTTGGG - Intergenic
1020062928 7:5166157-5166179 CCACCATGCCTGGCTAATTTTGG + Intergenic
1020084267 7:5302236-5302258 CCACCATACCTGGCTGAGACTGG + Intronic
1020266954 7:6567180-6567202 CCACCATGCCTGGCCATGCCTGG - Intergenic
1020283116 7:6661040-6661062 CCACCATGCCTGGCTAATTTTGG - Intergenic
1021518452 7:21512848-21512870 CCACCATGCCCGGCTAGGAAAGG + Exonic
1022165989 7:27762797-27762819 CCACCATGCCTGGCTAATTTTGG - Intronic
1022470716 7:30680496-30680518 TCAGCATGCCTGATTCAGACTGG - Intronic
1022734134 7:33060450-33060472 CCACCATGCCTAGCCATGACTGG + Intronic
1023774863 7:43595561-43595583 GCACCATGCCTGGCTTCAACTGG + Intronic
1023927450 7:44680057-44680079 CCACCATGCCTGGCTAATTTTGG - Intronic
1024083387 7:45874070-45874092 CCACCATGCCTGGCTAATTTTGG + Intergenic
1025100071 7:56127081-56127103 CCACCATGCCTGGCTAATTTTGG - Intergenic
1025210022 7:57014961-57014983 CCACCACACCTGGCTGAGACTGG - Intergenic
1025638081 7:63341296-63341318 CCACTATGCCTGGCCAAGATTGG - Intergenic
1025644615 7:63406803-63406825 CCACTATGCCTGGCCAAGATTGG + Intergenic
1025661929 7:63561890-63561912 CCACCACACCTGGCTGAGACTGG + Intergenic
1025774203 7:64544969-64544991 CCACCATGCCTGGCCAACACAGG - Intronic
1026039603 7:66856577-66856599 CCACCGTGCCTGGCCAAGACAGG + Intergenic
1026280230 7:68915741-68915763 TTGCCATGCCTGGCTCAGGCTGG - Intergenic
1026346479 7:69478780-69478802 CCACCCTGCCTGGCCAAAACAGG + Intergenic
1026781135 7:73268262-73268284 CCACCATGCCTGGCTAACTTTGG + Intergenic
1026853183 7:73737416-73737438 TCCCTATGTCTGCCTAAGACTGG - Intronic
1027003177 7:74668857-74668879 CCACCGTGCCTGGCTAAGAAGGG + Intronic
1027021988 7:74821704-74821726 CCACCATGCCTGGCTAACTTTGG + Intronic
1027047720 7:75002211-75002233 CCACCATGCCTGGCCAGGAAAGG + Intronic
1027066033 7:75124213-75124235 CCACCATGCCTGGCTAACTTTGG - Intronic
1027174293 7:75893493-75893515 CCACCATGCCTGGCTAATTTAGG + Intergenic
1027192401 7:76004414-76004436 CCACCATGCTTGGCCAAGATAGG - Intronic
1027671392 7:81104135-81104157 CCACCATGCCTGGCCATGATTGG - Intergenic
1027775218 7:82456444-82456466 GCACCATGCCTGGCTAATTTTGG + Intergenic
1028515404 7:91672765-91672787 CTACCATGCCTGGCCCAGACTGG - Intergenic
1029305171 7:99613902-99613924 TCACCAAAATTGGCTAAGACTGG - Intergenic
1029331645 7:99861159-99861181 CCACCATGCCTGGCCTAAACAGG + Intronic
1029406391 7:100376631-100376653 CCATCATGCCAGGCTAACACAGG + Intronic
1029472664 7:100764340-100764362 CCACCATGCCTGGCTAATTTTGG - Intronic
1029610004 7:101621871-101621893 CCACCATGCCTGGCCAAGGCAGG + Intronic
1029700253 7:102241815-102241837 TTACCACGCCTGGCTAATCCTGG - Intronic
1029865035 7:103618963-103618985 CCACCATGCCTGGCTAATTTTGG - Intronic
1030022855 7:105292993-105293015 CCACCACGCCTGGCCAAGCCTGG - Intronic
1030049427 7:105524554-105524576 TCACCATGCCTGGCCCAGATTGG - Intergenic
1030057869 7:105599282-105599304 CCACTACGCCTGGCCAAGACTGG - Intronic
1030208707 7:106975416-106975438 TCACCATGCCTGGCTGAGCAGGG + Intergenic
1030232399 7:107222132-107222154 TTACCAGGCCTGGCTTAGACAGG - Intronic
1030307083 7:108029830-108029852 CCACCACGCCTGGCCAAGAAAGG - Intronic
1030308502 7:108044798-108044820 CCACCATGCCTGGCTAATTTTGG - Intronic
1031859124 7:126958001-126958023 TCCCAATGTCTGTCTAAGACTGG - Intronic
1031925006 7:127630729-127630751 CCACCATGCCCGGCTATGCCCGG + Intergenic
1031925148 7:127631885-127631907 CCACCATGCCCGGCTATGCCCGG + Intergenic
1032040793 7:128558902-128558924 CCACCATGCCTGGCTAATTTTGG + Intergenic
1032287775 7:130555537-130555559 CCACCGTGCCTGGCTGACACTGG - Intronic
1032599391 7:133277112-133277134 CCACCACGCCTGGCTATAACTGG + Intronic
1032783796 7:135185020-135185042 CCACCATGCCTGGCTAATTTTGG + Exonic
1033073632 7:138227816-138227838 CCACCATGCCTGGCTAAGAAAGG - Intergenic
1033128858 7:138728377-138728399 TCACCATGCCTGGCTAATTTTGG + Intronic
1033312084 7:140268780-140268802 CCACCATGCCAGGCCTAGACTGG - Intergenic
1033434360 7:141319688-141319710 CCACCATGCCTGGCTAATTTTGG + Intronic
1033920551 7:146386539-146386561 CCACCATGCCTGGCTAATTTTGG + Intronic
1034145428 7:148867037-148867059 CCACCACGCCTGGCCAAGACTGG - Intronic
1034152810 7:148929951-148929973 GCACGGTGCCTGGCTGAGACAGG - Intergenic
1034510908 7:151533866-151533888 CCACCGTGCCAGGCTGAGACAGG + Intergenic
1034904286 7:154930192-154930214 CCACCATGCCTGGCTGAAATTGG + Intronic
1035960287 8:4128921-4128943 CCACCATGCCCGGCTAAAACAGG - Intronic
1036399484 8:8395511-8395533 CCACCATGCCTGGCCATGTCTGG - Intergenic
1036686371 8:10914220-10914242 ACCCCCTGCCTTGCTAAGACCGG - Intronic
1037082056 8:14799494-14799516 TCACCATGCCAGGGTTAGACTGG - Intronic
1037574884 8:20192514-20192536 CCACCATGCCTGGCTGTGTCAGG - Intergenic
1037633593 8:20679988-20680010 CCACCACACCTGGCCAAGACAGG - Intergenic
1037728714 8:21505771-21505793 CCACCATGCCTGGCTAATTTTGG - Intergenic
1038199320 8:25396931-25396953 TCACCGTGCCTGGCCAAGTCAGG - Intronic
1038508230 8:28105092-28105114 CCACCATGTCTGGCCAAGCCTGG - Intronic
1038714249 8:29977603-29977625 CCACCATGCCTGGCTAATTTTGG - Intergenic
1038760147 8:30378444-30378466 TCACCACGCCTGGCTAATTTTGG + Intergenic
1038827634 8:31022121-31022143 CCACCATGCCTGGCTAATTTTGG + Intronic
1039450690 8:37672736-37672758 TCACCATGCCTGGCTGACCCAGG - Intergenic
1039792527 8:40887191-40887213 CCACCGTGCCTGGCCAAAACCGG - Intronic
1039925439 8:41927497-41927519 CCACCATGCCTGGCCATGTCTGG - Intergenic
1040025772 8:42780751-42780773 CCACCATGCCTGGCTAATTTTGG + Intronic
1040043904 8:42941970-42941992 TCACCGTACCTGGCCAAGATTGG - Intronic
1040445726 8:47491694-47491716 CCACCATGCCAAGCTAATACTGG - Intronic
1040870216 8:52092851-52092873 CCACCATGCCTGGCCGAGATAGG + Intergenic
1042275539 8:67001332-67001354 TCACCATGCCCGGTTAAGATTGG + Intronic
1042337874 8:67647461-67647483 ACACCATGCCTGGATTTGACAGG + Intronic
1042746159 8:72108849-72108871 CCACCATGCCCCGCTAAGATAGG - Intronic
1042794453 8:72645448-72645470 TTACTATGCCTAGCTAAGGCAGG - Intronic
1043468424 8:80537464-80537486 TTACCATACCTGGTTATGACCGG - Intergenic
1043596855 8:81897554-81897576 CCACCATGCCTGGCTAATTTTGG - Intergenic
1045031989 8:98145751-98145773 CCACCATGCCTGGCTAATTTTGG - Intronic
1045171002 8:99668201-99668223 TCACCATGCCTGGTTAATTCAGG - Intronic
1045520793 8:102901259-102901281 CCACCATGCCTGGCCATGTCTGG - Intronic
1045610505 8:103835386-103835408 CCACCGTGCCTGGCCAAGACTGG + Intronic
1046537909 8:115539703-115539725 CCACCATGCCTGGCTAATTTTGG - Intronic
1046560203 8:115827000-115827022 CCACCATGCCTGGCTAATTTGGG + Intergenic
1046821343 8:118637385-118637407 TCACCACGCCTGGCCTAGAGTGG - Intergenic
1046941660 8:119937245-119937267 TCACCACGCCTGGCTAATTTTGG - Intronic
1047508452 8:125497883-125497905 TCTCCATGCCTGGCCCACACTGG - Intergenic
1048854272 8:138673360-138673382 CCACCATGCCTGGCTAACTTTGG + Intronic
1049523185 8:143105434-143105456 CCACCATGCCTGGCCAGGCCAGG + Intergenic
1049856638 8:144866256-144866278 CCACCATGCCTGGCCAGGAATGG + Intergenic
1049980349 9:898404-898426 TCACCGTGCCTGGCCCAGAGAGG + Intronic
1050190019 9:3015139-3015161 TCAAGATGCCTGGCCAGGACTGG - Intergenic
1050267429 9:3905747-3905769 TCAGTATCCCTTGCTAAGACAGG + Intronic
1050958357 9:11693872-11693894 CCACCATGCCTGGCTAATTTTGG + Intergenic
1051504562 9:17813167-17813189 CCACCGCGCCTGGCTATGACTGG - Intergenic
1051504617 9:17813589-17813611 CCACCATGCCTGGCCAGGACAGG - Intergenic
1051640447 9:19220039-19220061 CCACCATGCCTGGCTAATTTTGG - Intergenic
1052660333 9:31420590-31420612 CCACCATGCCTGGCTAATTTTGG - Intergenic
1052808357 9:33033847-33033869 AAACCATGACTGGCTAACACTGG - Intronic
1053326125 9:37153321-37153343 CCACCATGCCTGGCTAATTTTGG + Intronic
1053414522 9:37938726-37938748 GCTCCATCCCTGGCTCAGACGGG + Intronic
1053789718 9:41678276-41678298 CCACCACACCTGGCTAACACCGG - Intergenic
1054155426 9:61636477-61636499 CCACCACACCTGGCTAACACCGG + Intergenic
1054178056 9:61889966-61889988 CCACCACACCTGGCTAACACCGG - Intergenic
1054475212 9:65567588-65567610 CCACCACACCTGGCTAACACCGG + Intergenic
1054659473 9:67690858-67690880 CCACCACACCTGGCTAACACCGG + Intergenic
1054895991 9:70311968-70311990 CCACCATGCTAGGCTAATACAGG - Intronic
1054916201 9:70497402-70497424 CCACCGTGCCTGGCCAAGAAAGG + Intergenic
1055383673 9:75737570-75737592 CCACCATGCCAGGCCAAGACTGG + Intergenic
1055652562 9:78420914-78420936 TCACCATGCCTGGCTAATTTTGG + Intergenic
1055710064 9:79050951-79050973 CCACCATGCCTGGCTAATTTTGG + Intergenic
1055892753 9:81141056-81141078 CCACCATGCCTGGCCATGCCTGG - Intergenic
1056983188 9:91336342-91336364 CCACCATGCCTGGCCAATCCAGG - Intronic
1057089131 9:92240414-92240436 CCACCATGCCTGGCTAATTTTGG + Intronic
1057439458 9:95072478-95072500 CCACTATGCCTGGATAAGAGTGG - Intronic
1058697123 9:107568809-107568831 CCACCATGCCTGGCCAAGTCTGG + Intergenic
1060664521 9:125424775-125424797 CCACCATGCCCGGCAAAGACAGG + Intergenic
1061097863 9:128470341-128470363 CCACCACGCCTGGCCAAGAAGGG - Intronic
1203653900 Un_KI270752v1:5149-5171 TCATCATGCCTGGCTATTGCTGG + Intergenic
1185560486 X:1056841-1056863 CCACCACGCCTGGCCAAGTCTGG + Intergenic
1185714971 X:2334315-2334337 CCACCATGCCTGGCTAATATTGG + Intronic
1185740524 X:2528280-2528302 CCACCATGCCTGGCCAAGACTGG + Intergenic
1185907260 X:3947092-3947114 TCACCATGCCTGGACATGAGTGG - Intergenic
1186880922 X:13865442-13865464 CCACCGTGCCTGGCTGAGAATGG - Intronic
1187221045 X:17326590-17326612 TCACCACGCCAGGCCAAGACGGG - Intergenic
1187928789 X:24275099-24275121 TCACCACGCCTGGCCCAGAATGG - Intergenic
1188206281 X:27363228-27363250 CCACCGTGCCCGGCCAAGACTGG + Intergenic
1188592615 X:31857089-31857111 CCACCATGCCTGGCCAAGATTGG - Intronic
1189345420 X:40237516-40237538 CCACCATGCCTGGCTAAAAGTGG + Intergenic
1189541564 X:41996668-41996690 CCACCATGCCTGGCTAATTTTGG + Intergenic
1189827414 X:44933728-44933750 CCACCATGCCTGGCTAATTCTGG + Intronic
1189903768 X:45736165-45736187 CCACCATGCCTGGCCGAGTCAGG - Intergenic
1190850319 X:54234084-54234106 ACACCATGCCTGGCCTAGAAGGG - Intronic
1190866492 X:54389219-54389241 CCACCATGCCTGGCTAGGGGTGG - Intergenic
1191967154 X:66771679-66771701 GCACCATGCCTGGCTAATTTTGG + Intergenic
1192259736 X:69498076-69498098 CCACCATGCCTGGCCCACACTGG - Intergenic
1193472039 X:81917981-81918003 ACACCATGCCTGGCTAATTTGGG - Intergenic
1193673319 X:84416865-84416887 CCACCATGCCCGGCCAGGACTGG - Intronic
1194454361 X:94083604-94083626 ACACCATGCCTGGCTAATTTTGG + Intergenic
1194671991 X:96745157-96745179 CCACCATGCCTGGCTAATTTTGG + Intronic
1196742287 X:119035833-119035855 CCACCATGCCTGGCTAATTTTGG - Intergenic
1196781944 X:119391583-119391605 CCACCGTGCCTGGCCAAGACTGG - Intergenic
1197046886 X:122008355-122008377 CCACCATGCCTAGCTAGGACAGG + Intergenic
1197659320 X:129152613-129152635 CCACCATGCCTGGCCTAGAATGG + Intergenic
1198257589 X:134938017-134938039 CCACCATGCCCGGCTAATTCGGG + Intergenic
1198617926 X:138479103-138479125 CCACCATGCCTGGCTAATTTTGG + Intergenic
1198811785 X:140543373-140543395 TCACCATCCTGGGCTAAAACTGG - Intergenic
1199965060 X:152812836-152812858 TCACCACGCCTGGCTAAAGAAGG - Intergenic
1201901744 Y:19050568-19050590 CCACCATGCTTGGCCAAGTCTGG + Intergenic