ID: 932284092

View in Genome Browser
Species Human (GRCh38)
Location 2:70518183-70518205
Sequence CTCGGGACAGGAAGGCTTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 156}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932284079_932284092 18 Left 932284079 2:70518142-70518164 CCTGCCTAAGTTTCAAAGCAGGT 0: 1
1: 0
2: 0
3: 9
4: 172
Right 932284092 2:70518183-70518205 CTCGGGACAGGAAGGCTTCTAGG 0: 1
1: 0
2: 0
3: 12
4: 156
932284085_932284092 -10 Left 932284085 2:70518170-70518192 CCCGCCGCAGGCCCTCGGGACAG 0: 1
1: 0
2: 2
3: 17
4: 216
Right 932284092 2:70518183-70518205 CTCGGGACAGGAAGGCTTCTAGG 0: 1
1: 0
2: 0
3: 12
4: 156
932284076_932284092 30 Left 932284076 2:70518130-70518152 CCACAGGCTCCTCCTGCCTAAGT 0: 1
1: 0
2: 0
3: 57
4: 516
Right 932284092 2:70518183-70518205 CTCGGGACAGGAAGGCTTCTAGG 0: 1
1: 0
2: 0
3: 12
4: 156
932284080_932284092 14 Left 932284080 2:70518146-70518168 CCTAAGTTTCAAAGCAGGTCCTT 0: 1
1: 0
2: 0
3: 7
4: 214
Right 932284092 2:70518183-70518205 CTCGGGACAGGAAGGCTTCTAGG 0: 1
1: 0
2: 0
3: 12
4: 156
932284082_932284092 -5 Left 932284082 2:70518165-70518187 CCTTGCCCGCCGCAGGCCCTCGG 0: 1
1: 0
2: 1
3: 23
4: 244
Right 932284092 2:70518183-70518205 CTCGGGACAGGAAGGCTTCTAGG 0: 1
1: 0
2: 0
3: 12
4: 156
932284077_932284092 21 Left 932284077 2:70518139-70518161 CCTCCTGCCTAAGTTTCAAAGCA 0: 1
1: 0
2: 1
3: 20
4: 189
Right 932284092 2:70518183-70518205 CTCGGGACAGGAAGGCTTCTAGG 0: 1
1: 0
2: 0
3: 12
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932284092 Original CRISPR CTCGGGACAGGAAGGCTTCT AGG Intronic
900683476 1:3931972-3931994 CACGGGAGGGGAAGGCTTTTAGG - Intergenic
901098714 1:6702629-6702651 TTCTGGGCAGGAAGGCTTCTGGG - Intergenic
901737996 1:11324472-11324494 GGGGGGACAGGAAGGCTTCCTGG + Intergenic
903173136 1:21565751-21565773 CTGGGGACTGGGAGGCTTTTGGG - Intronic
903953182 1:27008239-27008261 CTCAGGACAGGAATGCTGCCTGG - Intronic
904940350 1:34161802-34161824 ATAGGGCCAAGAAGGCTTCTTGG + Intronic
907395831 1:54189400-54189422 ATCGGGACAGGAAGGGTGGTGGG + Intronic
912225462 1:107728374-107728396 CTCTGTAGAGGAAGTCTTCTGGG + Intronic
913088255 1:115458707-115458729 TTCTGGACAGGATAGCTTCTGGG - Intergenic
913131131 1:115838994-115839016 CTGGGGGCGGGAAGGCTTCTTGG + Exonic
915040344 1:152963104-152963126 CTCTGGCCAGGAAACCTTCTGGG - Intergenic
915342597 1:155184611-155184633 CTTGGGACAGGCAGGCTTTGGGG + Exonic
917959104 1:180128461-180128483 CTCGGAACACAAAGGCTTCCCGG + Intergenic
922000817 1:221476594-221476616 CTCAGGACAGTAAGTGTTCTGGG + Intergenic
923031774 1:230254917-230254939 CTTGAGACAAGAATGCTTCTTGG - Intronic
1067087280 10:43249640-43249662 CTCGGGCCAGCAAGGCATCCTGG + Intronic
1067712414 10:48659393-48659415 ATCGGGACATTAAGGCTCCTGGG + Intergenic
1071475172 10:86019428-86019450 CTGGGGACTGGAGGGCTTCGGGG + Intronic
1072152322 10:92692576-92692598 CCGGGGAAGGGAAGGCTTCTGGG + Intronic
1073651608 10:105366539-105366561 ATCGGGGCAGGAAGTTTTCTTGG + Intergenic
1075852844 10:125603135-125603157 CTTAGGACAGGAAGGCTGGTTGG - Intronic
1077191503 11:1257678-1257700 CTCGGGGCAGCAGGGGTTCTCGG - Exonic
1080637182 11:34134368-34134390 CTCGAGGCAAGAAGGCTTCAGGG + Exonic
1083482300 11:62957262-62957284 CTCTGGACAGCAAGGAATCTAGG + Intronic
1083620542 11:64047254-64047276 CTCGGGCCAGGAAGGCTTGCTGG - Intronic
1085050952 11:73380019-73380041 TTCGGGCCAGGAGGGCTTCCTGG - Intronic
1089258148 11:117204852-117204874 CAGGGGACAGGCAGGCATCTCGG + Exonic
1089496651 11:118911435-118911457 CTCTGGGGAGGAAGGCTCCTGGG + Intronic
1090003261 11:122979847-122979869 CTGGGGACAGGACTGCTCCTGGG - Intronic
1090276965 11:125427086-125427108 CTATGGACAGGGAGGCTGCTTGG + Intronic
1094359683 12:29616826-29616848 CTAAGCACAGGAAGGCTTCTTGG + Intronic
1097022171 12:56028106-56028128 CTCTGGGCAGCAAGGCTTCATGG + Intronic
1097961485 12:65535791-65535813 CTTGGGACAGAAAGACTTCCTGG - Intergenic
1098132573 12:67365805-67365827 CTGGGGACTCTAAGGCTTCTTGG + Intergenic
1098244016 12:68497723-68497745 TTGGGGTCAGGAAGGGTTCTTGG - Intergenic
1101658205 12:106742953-106742975 CACAGGACAGGAAGGGTGCTCGG - Intronic
1101950269 12:109169268-109169290 CTTGGGGCAGGAAGGCTTAGGGG - Intronic
1102720282 12:115010080-115010102 CTCAGGATAGGAAGGCTTTCTGG + Intergenic
1104124885 12:125837030-125837052 GTAGGGACAGGAACTCTTCTAGG + Intergenic
1104415600 12:128594635-128594657 TTCAGCACAGGGAGGCTTCTGGG + Intronic
1104475109 12:129064589-129064611 CTAGGGAAAGCCAGGCTTCTGGG + Intergenic
1113864063 13:113509454-113509476 GTTGGGACTGGCAGGCTTCTTGG + Intronic
1115750948 14:36489222-36489244 CTCTTGTCAGGAAGGCTTTTAGG + Intronic
1116400222 14:44497383-44497405 CTGGGGACAAAGAGGCTTCTGGG - Intergenic
1117439476 14:55746310-55746332 TCTGGGACAGGAAGGCTGCTGGG - Intergenic
1118257313 14:64216284-64216306 CTCGGGACAGGAAGGGCTGTCGG - Exonic
1118736870 14:68707192-68707214 CTTGTGATAGGAAGGCTTCCTGG - Intronic
1119205228 14:72788987-72789009 CTGGGGATAGGAAGGCTTTGAGG - Intronic
1119640369 14:76310213-76310235 CAGGGGCCAGGCAGGCTTCTTGG - Intergenic
1120689353 14:87575709-87575731 CTCGAGTTAGGGAGGCTTCTAGG - Intergenic
1121263199 14:92581508-92581530 GGGTGGACAGGAAGGCTTCTTGG + Intronic
1121397717 14:93641706-93641728 CTTGGACCAGGAAGCCTTCTTGG + Intronic
1122251873 14:100445630-100445652 ACGGGGACAGGATGGCTTCTAGG + Intronic
1122790040 14:104180371-104180393 CTCGGGACAGAGCGGGTTCTCGG - Intronic
1125893872 15:43286111-43286133 CTGCAGACAGGAAGCCTTCTTGG - Intronic
1127427985 15:58874764-58874786 CTCTGGACAGGTAGCCTGCTAGG - Intronic
1128982484 15:72197642-72197664 CGCGGGGCAGGACGGCTCCTGGG - Intronic
1129166868 15:73783445-73783467 GTGGAGACAGGAAGGCTTCCTGG - Intergenic
1129915404 15:79265734-79265756 CTCAGGACTGGGAGGGTTCTTGG + Intergenic
1130168436 15:81486487-81486509 CTGGGGACAAGTTGGCTTCTTGG + Intergenic
1134320620 16:13159333-13159355 CTAGGAAAAGGAAGCCTTCTGGG - Intronic
1139507176 16:67404622-67404644 CTCAGGACAGTCAGGCTTCCTGG + Intronic
1139631364 16:68233923-68233945 CTCAGGACAAGAGGGGTTCTGGG + Intronic
1142309400 16:89303554-89303576 CTGGGGACAGGAAGGCTGCAGGG - Intronic
1142990121 17:3724556-3724578 CTCGGTCCAGGGAGACTTCTGGG - Exonic
1143514266 17:7411527-7411549 GTGGGGAGCGGAAGGCTTCTGGG + Intronic
1146012532 17:29207276-29207298 CTTGGGAGATGGAGGCTTCTGGG + Intergenic
1147923482 17:43932764-43932786 CGCGGGGGAAGAAGGCTTCTGGG + Intergenic
1147948850 17:44095863-44095885 CTGGGGAGAGGAAGGCTGCTGGG + Intronic
1148186703 17:45649665-45649687 CTCTGCAGAGGAAGGCTTCTTGG + Intergenic
1148656709 17:49289614-49289636 CTGGGGAGAGGAGGGCTGCTTGG - Intronic
1150501334 17:65653627-65653649 CTGGGCACAGGAAGGCTTGCTGG + Intronic
1151602651 17:75115762-75115784 CTGGGGTCAGGCAGGCATCTGGG + Intronic
1157128062 18:44976442-44976464 CTCAGGAAAGGCAGGCTGCTGGG + Intronic
1160831251 19:1105821-1105843 CTGGGGACAGTACGGCTGCTGGG + Intronic
1163675197 19:18652243-18652265 CTCGGGCCAGGAGGTCTTGTGGG + Intronic
1166071962 19:40393138-40393160 CCCAGGACAGGCAGGCTTCCTGG + Intergenic
1167211658 19:48137441-48137463 CGTGTGTCAGGAAGGCTTCTGGG - Intronic
1167510362 19:49892637-49892659 ATGGGGGCAGCAAGGCTTCTGGG - Intronic
1168687755 19:58358586-58358608 CTGGGGACAGGAAGGCAGCAGGG + Intronic
925197114 2:1934807-1934829 CTGGGGACAGGGAGTCTTCACGG - Intronic
927489427 2:23510835-23510857 GTCAGGACTGGCAGGCTTCTGGG + Intronic
928423635 2:31159946-31159968 CCCAGGCCAGGAAGGCTTCCAGG - Intergenic
931534404 2:63256931-63256953 GTGGGTATAGGAAGGCTTCTGGG + Intronic
932284092 2:70518183-70518205 CTCGGGACAGGAAGGCTTCTAGG + Intronic
942397011 2:175560866-175560888 CTCAGGCCAGACAGGCTTCTGGG - Intergenic
942708307 2:178802125-178802147 CTCGTGAAAGGTAGGCTGCTGGG - Exonic
946352493 2:219164449-219164471 GACTGGCCAGGAAGGCTTCTTGG - Intronic
946364906 2:219243057-219243079 GTCGGGACAGGAAGACTGCCAGG - Intronic
1172181221 20:33004692-33004714 CTTGGGGCAGGAAGGGATCTAGG - Intergenic
1173863965 20:46302547-46302569 CTGGGTCCAAGAAGGCTTCTGGG + Intronic
1174466133 20:50718981-50719003 CAAGGGACTGGAAGGTTTCTTGG + Intergenic
1181100822 22:20537602-20537624 AAGGGGACAGGAATGCTTCTGGG - Intronic
1181423107 22:22815455-22815477 GTCAGGACAGGAAGGCTCCTGGG - Intronic
1181582014 22:23833823-23833845 CTAGAGGCAGGCAGGCTTCTGGG + Intronic
1182862851 22:33575411-33575433 GTGAGGCCAGGAAGGCTTCTTGG + Intronic
1183476784 22:38039901-38039923 GTTGGGAAAGGAAGGCTTCCTGG + Intronic
1183931665 22:41239021-41239043 CACTGGAGAGGAAGGCTTCCTGG - Intronic
1183973197 22:41494045-41494067 ATCAGGACAGGAAGTCCTCTTGG + Intronic
1184048198 22:41985334-41985356 CACAGGACACTAAGGCTTCTGGG + Intronic
1184450940 22:44582401-44582423 CTGGGAGCAGGAAGGCTTTTGGG - Intergenic
1184496748 22:44846577-44846599 CCGGGGACAGGCAGGCCTCTTGG - Intronic
1184643735 22:45885367-45885389 CTGGGGCCAGGAAGGCTGCGGGG - Intergenic
1184831840 22:46993825-46993847 CTGGGGCCAGGAAGCCTTCAAGG - Intronic
950726450 3:14920188-14920210 CAGGGGTCAGCAAGGCTTCTGGG + Intronic
954406850 3:50349998-50350020 CTCGGGAGATGAAGTCTTCAGGG + Exonic
955918003 3:63925766-63925788 ATCAGGAAAGGAAGGCTTCCTGG + Intronic
957005934 3:74946809-74946831 CTGTGGACAGGCAGGCTCCTTGG - Intergenic
958640675 3:96800883-96800905 CGCGGGACAGGCTGCCTTCTTGG - Intergenic
961886982 3:130102878-130102900 CCAGGGACACGATGGCTTCTGGG + Intronic
962406453 3:135104580-135104602 CTCTGCAAAGTAAGGCTTCTTGG + Intronic
963533617 3:146500924-146500946 TTTGGGGCAGGAAGGCTTCCTGG - Intergenic
965578185 3:170239672-170239694 ATGGAGATAGGAAGGCTTCTTGG - Intronic
968996134 4:3946882-3946904 CTAGCGACACGATGGCTTCTGGG + Intergenic
970173982 4:13318953-13318975 CCCAGGACAGGAGGGCTTCATGG - Intergenic
980075164 4:128287297-128287319 CTTCGGACAGGGAGGCCTCTGGG - Intronic
982368211 4:154603825-154603847 CTGGAGACAGGAAAGCTGCTTGG - Intergenic
985765029 5:1773001-1773023 CTGGGGAGAGGAAAGCTTCTTGG + Intergenic
987123292 5:14788077-14788099 CTGGGTCCAAGAAGGCTTCTTGG + Intronic
995223337 5:109675982-109676004 CTCTTGACAGCCAGGCTTCTAGG + Intergenic
995575942 5:113533898-113533920 CTCGAGACAGAAAGGGTTTTAGG - Intronic
997162731 5:131625936-131625958 CTAGAGACAGGGAGGCTTATAGG - Intronic
997700216 5:135892569-135892591 CTCTTGGCAGGTAGGCTTCTGGG - Intronic
998129196 5:139642879-139642901 CTCAGGAGAGGCAGGCCTCTGGG - Intergenic
1001036944 5:168303787-168303809 CTCGGGAGAGGAAGGGTCCCTGG + Intronic
1003891159 6:10564996-10565018 AATGGGACAGGAAGGCTTCTTGG + Intronic
1006552288 6:34834524-34834546 CACTGGACAGAAAGGCCTCTGGG - Intronic
1006643516 6:35500684-35500706 GGGGGGTCAGGAAGGCTTCTTGG - Intronic
1006912523 6:37572586-37572608 CTGGAGACAGGGAGCCTTCTGGG + Intergenic
1007315289 6:40983317-40983339 CCAGGGGCAGCAAGGCTTCTGGG - Intergenic
1007327555 6:41073532-41073554 CTTGGGACAGGAAGCCTCCCCGG + Intronic
1013488934 6:110625865-110625887 TTCAGGACAGGATGGCTTATAGG - Intronic
1013953381 6:115811983-115812005 CTCTGGCCAGAAAGGTTTCTAGG - Intergenic
1014442935 6:121494222-121494244 CACGGGATAAGAATGCTTCTAGG - Intergenic
1017129908 6:151099359-151099381 CTTGGGACAGGAGGGGTGCTAGG - Intronic
1018248684 6:161846525-161846547 CTGGGGACAGGGAGCCTGCTTGG - Intronic
1019768959 7:2871335-2871357 CTGGGGTCAGGGAGGCTTCCTGG + Intergenic
1020062253 7:5161149-5161171 GGCGGGACAGGACGGCTCCTGGG - Intergenic
1020165893 7:5807528-5807550 GGCGGGACAGGACGGCTCCTGGG + Intergenic
1024295721 7:47840505-47840527 CTCTGGACAGGAGAGCTCCTTGG + Exonic
1024675109 7:51631220-51631242 CCCGGGAGAGGGAGGCTTGTTGG - Intergenic
1026409011 7:70099557-70099579 CTAGTGACAGTAAGGTTTCTGGG + Intronic
1026778545 7:73247802-73247824 CTCAGCACTGGAAGGGTTCTAGG + Intergenic
1027019400 7:74801204-74801226 CTCAGCACTGGAAGGGTTCTAGG + Intronic
1027068626 7:75144737-75144759 CTCAGCACTGGAAGGGTTCTAGG - Intronic
1027260985 7:76464391-76464413 CTCGGGAGTGGAAGGATTTTAGG + Intronic
1027312362 7:76962503-76962525 CTCGGGAGTGGAAGGATTTTAGG + Intergenic
1030895506 7:115054665-115054687 GTCGGGACTGGAAGCCTTCTTGG - Intergenic
1033537372 7:142324172-142324194 TGCGGGACAGGAAGGCTGCATGG + Intergenic
1036706720 8:11052192-11052214 CTCCTGCCTGGAAGGCTTCTTGG + Intronic
1037201096 8:16253042-16253064 GAGGGGGCAGGAAGGCTTCTGGG - Intronic
1037501146 8:19486532-19486554 CTCTGGGCAGGAATGCTTCGAGG - Intronic
1038923365 8:32110879-32110901 CTCCAGACAGCAATGCTTCTGGG - Intronic
1040543630 8:48380594-48380616 CCCGGGAGAGGACGGCTTCCAGG + Intergenic
1040805935 8:51396356-51396378 CTCTGGTCGGGAAGGCCTCTGGG - Intronic
1046576644 8:116038041-116038063 CTCAGTACAGGAAGTATTCTTGG + Intergenic
1047607795 8:126491861-126491883 CTTGGGACAGGCAGAGTTCTGGG - Intergenic
1049398086 8:142411234-142411256 GAGGGGTCAGGAAGGCTTCTTGG - Intergenic
1050713173 9:8489286-8489308 CCTGGGACAGAAAGGCTTGTTGG + Intronic
1051665514 9:19464358-19464380 CCCGGGTGAGGAAGGCTTCCTGG + Intergenic
1053537695 9:38942193-38942215 CTTGGGGCAGGAAGGGTGCTGGG + Intergenic
1054628439 9:67421737-67421759 CTTGGGGCAGGAAGGGTGCTGGG - Intergenic
1056581271 9:87889340-87889362 CACGGGGCAGGGAGGCTGCTGGG - Intergenic
1060827327 9:126694623-126694645 CTGGTGAGAGGGAGGCTTCTGGG + Intronic
1062550166 9:137082493-137082515 GTGGGGACAGAAAGGCTTCCAGG - Intronic
1192042868 X:67641635-67641657 GTAGGGAAAGGAAGGCTTGTGGG + Intronic
1196980138 X:121203871-121203893 CTCCAGACAGGATGGCTGCTTGG + Intergenic
1198437975 X:136635953-136635975 CTGGGGAAAGGAAGTCTCCTGGG - Intergenic
1199668190 X:150118889-150118911 CCCAGGACAGGAAGGCCTATTGG - Intergenic