ID: 932284689

View in Genome Browser
Species Human (GRCh38)
Location 2:70522278-70522300
Sequence GAGGGTGTACAGATGGGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 372}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932284689 Original CRISPR GAGGGTGTACAGATGGGGAA TGG Intronic
901844392 1:11972785-11972807 GAGGGTGCACACATGGGGCCTGG - Intronic
902164680 1:14560756-14560778 GAAGGAGTAAAGATGGAGAAGGG + Intergenic
902905985 1:19557799-19557821 GAAGGGGAACAGAAGGGGAAGGG - Intergenic
903213941 1:21832972-21832994 GAAGGAGCAGAGATGGGGAAAGG + Intronic
903221564 1:21872446-21872468 GAGGGTGTTAAGGTGCGGAATGG + Intronic
903259838 1:22125537-22125559 GATGGTTTAGACATGGGGAATGG + Intronic
903659108 1:24966078-24966100 GAGGGTGGAGAGTGGGGGAAAGG + Intergenic
904386873 1:30148664-30148686 GAGGGTGGGCAGATGGAGCAGGG + Intergenic
905257694 1:36695585-36695607 GGAGGGGAACAGATGGGGAAGGG + Intergenic
905975479 1:42170991-42171013 GAGGGGGAGCAGATGGTGAACGG - Intergenic
906004665 1:42457997-42458019 GAGGGTGTACGAAGTGGGAAAGG + Intronic
906413753 1:45602630-45602652 GGGGGTGGAGAGATGGGGAGAGG - Intronic
907328747 1:53657881-53657903 GAGGGTGCAGAGAAGGGGCAAGG - Intronic
907338504 1:53716371-53716393 GTGGGTGACCAGTTGGGGAAAGG + Intronic
913074590 1:115331091-115331113 GAGGGGGTCCACATCGGGAAGGG + Intronic
913167222 1:116199510-116199532 GAGCAGGTAAAGATGGGGAAGGG - Intergenic
913196326 1:116459177-116459199 GTGGGTGTACAGATGAGGAGTGG - Intergenic
915407546 1:155672675-155672697 GGGGTTGTACTGATGGTGAAGGG + Exonic
915420239 1:155775117-155775139 GGGGTTGTACTGATGGTGAAGGG + Exonic
915473680 1:156140025-156140047 GAAGGGGTGCAGATGGGAAATGG - Exonic
915511849 1:156390922-156390944 GGGGCTGGAAAGATGGGGAAGGG - Intergenic
917452189 1:175156406-175156428 GAGTGTGTGGTGATGGGGAAGGG + Intergenic
917512568 1:175680437-175680459 GAGTGTGTTAAGATGGGAAAGGG + Intronic
917690409 1:177462585-177462607 TAGGTTTTACAGATGGAGAAAGG + Intergenic
917708636 1:177660489-177660511 CAGGGTGCACAGCTTGGGAATGG + Intergenic
917925044 1:179782347-179782369 GTGGGGGCAGAGATGGGGAAGGG + Intronic
919161804 1:193840172-193840194 GAGAGAGGAGAGATGGGGAAGGG + Intergenic
922192220 1:223329399-223329421 GAGAGTGCACATATGGGGAAAGG - Intronic
922272092 1:224043674-224043696 GAGGGTGTGCTGAAGGGGAGGGG - Intergenic
922272123 1:224043773-224043795 GGGGGAGTACTGATGGGGAGAGG - Intergenic
923280855 1:232441706-232441728 GAGGGGGCAGAGAGGGGGAAAGG + Intronic
923301496 1:232644750-232644772 GAGTGTGAAGAGGTGGGGAATGG - Intergenic
924071449 1:240284514-240284536 AAGAGTGGACAGCTGGGGAAGGG - Intronic
1062779639 10:190370-190392 GAGGGTGTGCAGAAGAGGCAGGG - Intronic
1062940218 10:1415185-1415207 GTGGGTGAACAGATGGTGGATGG + Intronic
1063603622 10:7504785-7504807 GAGGGGGCAGAGTTGGGGAAGGG + Intergenic
1064964339 10:21000200-21000222 GAGGGGGTATAGAGGGGGCATGG + Intronic
1066047783 10:31608800-31608822 GAAGGTGTGCTGGTGGGGAAGGG - Intergenic
1066784104 10:38983267-38983289 GAGGGAGTAGAGAGGGGAAAGGG + Intergenic
1067013869 10:42740861-42740883 GGGAGTGTCCAGCTGGGGAAGGG + Intergenic
1067065066 10:43099681-43099703 GGAGGTGGACAGATTGGGAAGGG - Intronic
1068121728 10:52787577-52787599 GAAGGTGTATATATGTGGAATGG + Intergenic
1068387964 10:56357936-56357958 CAGGGTGTGCAGATGGGGAGGGG - Exonic
1069592533 10:69650927-69650949 GGGGGTCTCCAGATGGGGGACGG - Intergenic
1070514314 10:77189522-77189544 GATGAAGTACAGATGGGGAGGGG + Intronic
1070543201 10:77432132-77432154 GAAGGTGCTCAGAAGGGGAAAGG - Intronic
1070575019 10:77671099-77671121 GAGGGAGGAGAGGTGGGGAAGGG + Intergenic
1070584067 10:77747806-77747828 TAGGGTGTCCGGAAGGGGAATGG + Intergenic
1070651413 10:78239807-78239829 GAAGGGGTGCAGATGGGAAATGG + Intergenic
1071252619 10:83836430-83836452 GAGGGTGTTCTGCTGGGGAATGG + Intergenic
1071753728 10:88511553-88511575 GAGAAGGTATAGATGGGGAAGGG + Intronic
1072101248 10:92231492-92231514 GAGAGTGGACAGAAGGGAAAAGG - Intronic
1072189604 10:93069034-93069056 GAGGGTGCATGGATGGGGGAAGG + Intergenic
1072728171 10:97827573-97827595 GAGGGAGGAAAGATGGGGAGGGG - Intergenic
1072801152 10:98393241-98393263 GAGGGTGTAGAGAAGGCAAAGGG - Intronic
1073079583 10:100850651-100850673 GGAGGTGTAGAGGTGGGGAAGGG - Intergenic
1073127147 10:101158434-101158456 GTGGGGGTGGAGATGGGGAAAGG - Intergenic
1074092968 10:110280360-110280382 GAGGGTATACAGTTGGGGTAAGG + Intronic
1074267628 10:111920638-111920660 GAGGGTGTGAAGAGGAGGAAGGG - Intergenic
1074360402 10:112820854-112820876 GAGGGTGGACAGGTGAGGGATGG + Intergenic
1075000506 10:118793650-118793672 GAGGGTGTAAATACAGGGAAGGG - Intergenic
1075091691 10:119447373-119447395 GAGGGTGCAGAGATGGGTCAAGG - Intronic
1076323871 10:129605414-129605436 AATGATGTACAGATGGGGACAGG - Intronic
1077280515 11:1742952-1742974 GAGGATGGACAGATGGAGGATGG + Intronic
1077280591 11:1743354-1743376 GAGGATGGACAGATGGAGGATGG + Intronic
1078333023 11:10441551-10441573 GAGGGAGGAGACATGGGGAATGG - Intronic
1080379229 11:31750261-31750283 AAGGGAGTACAGATTGGTAATGG + Intronic
1080666124 11:34337941-34337963 GAGGATGTACAGTTTGGGAAAGG - Intronic
1080891586 11:36413222-36413244 GAGAGTGAAGAGATGAGGAAAGG - Intronic
1081320893 11:41690221-41690243 GAGGGTGCATGGAAGGGGAATGG - Intergenic
1081807288 11:45897421-45897443 GAGGCTGCACAGATGGGGTCAGG - Intronic
1081993081 11:47347915-47347937 AAGGGTGGAGAGATGGGGGAAGG + Intronic
1082132339 11:48506162-48506184 GAGGGGGAAGGGATGGGGAAGGG - Intergenic
1082172197 11:49018451-49018473 AAGGGTGTAACGTTGGGGAAGGG + Intergenic
1082781387 11:57290225-57290247 GTGAGTGCACAGATGGTGAATGG + Intergenic
1083731623 11:64655426-64655448 GAGGCTGGACAGAAGAGGAAGGG + Intronic
1084178419 11:67435101-67435123 GAGGGGGGACGGATGGGGAGAGG - Exonic
1085262814 11:75217884-75217906 GAGGGTGTACAAATAGGGCCTGG + Intergenic
1086007452 11:82054517-82054539 GAGAGTGAACAGCTGGAGAATGG - Intergenic
1086510309 11:87550171-87550193 GAGGGTGGACAGTGGGAGAAGGG - Intergenic
1087272279 11:96123725-96123747 CAGTGTGCACAGATGGGGAAGGG + Intronic
1088871576 11:113894654-113894676 GAGGGAGTGCAGAAGAGGAACGG - Intergenic
1088968443 11:114749716-114749738 GAGGGTGTTCACATGAAGAAGGG - Intergenic
1089559781 11:119338021-119338043 GAGGCTGTGCAGATGGGGCTGGG + Intergenic
1091287102 11:134413422-134413444 GAGGATGTGCAGGTGGGGAGGGG + Intergenic
1091301086 11:134508698-134508720 GAGGGTGAAGGGACGGGGAATGG + Intergenic
1092091713 12:5809129-5809151 GAGGGAGTGCAGATGGGGGAAGG + Intronic
1092139629 12:6173950-6173972 GAGGGTGAACAGATGCTAAATGG + Intergenic
1092872038 12:12813706-12813728 GAGGTTGTACATATGGGGAATGG + Intronic
1093052806 12:14522148-14522170 GAGGGAGAAGAGATGGAGAAGGG + Intronic
1093178111 12:15935996-15936018 GAGGGTGTTCACATGGTAAAGGG - Intronic
1094374184 12:29773141-29773163 GAGTGAGTTCAGATGGAGAAGGG - Intronic
1096413563 12:51393836-51393858 GAGGGTCTACAGATGGGCTAAGG - Intronic
1098056051 12:66506514-66506536 CAGGGGTTACACATGGGGAAGGG + Intronic
1098119958 12:67226234-67226256 GAGGGTGGGGAGATGGGGGAGGG - Intergenic
1100379830 12:94051226-94051248 CAGGGTGGACAGGTGGGGACTGG - Intergenic
1100595814 12:96071084-96071106 GTGGGTGCACAGATGGTGACAGG - Intergenic
1100972161 12:100081558-100081580 GAGGGTGGAGGGTTGGGGAAGGG - Intronic
1101502147 12:105314215-105314237 GGGAGTGTACAAATAGGGAATGG - Intronic
1101809872 12:108098444-108098466 GAGTGTGGGCAGATGGGGCAGGG - Intergenic
1102985294 12:117272870-117272892 GAGGGTGCTCAGTCGGGGAAGGG - Intronic
1104425681 12:128675716-128675738 GTGGGTGGACAGATGGAGGAAGG + Intronic
1105213953 13:18273700-18273722 GAGGGTGGAGGGATGGGAAATGG - Intergenic
1105472586 13:20705770-20705792 GAGGGTGTCCCAATGGGGCATGG + Intronic
1106405677 13:29470869-29470891 GAATGTGGAGAGATGGGGAAAGG - Intronic
1106415265 13:29541007-29541029 GAGTGTGCACAGAAGGGGCAGGG + Intronic
1106552573 13:30784839-30784861 GAAGGTTTACAGCTGGAGAATGG + Intergenic
1110731047 13:78878610-78878632 AAGGGTCTACAGATGTTGAATGG + Intergenic
1111077506 13:83257139-83257161 TTCGGTGCACAGATGGGGAATGG + Intergenic
1113824499 13:113240698-113240720 CAGGGTGTAGGGATGGGGCAGGG + Intronic
1114537857 14:23434207-23434229 GTGTGTCTACAGATGAGGAAAGG + Exonic
1114613680 14:24057464-24057486 CAGGGTGCACAGCTGGGGAAGGG - Intronic
1114775164 14:25473436-25473458 GAGGGTCTAAAGAAGAGGAAAGG + Intergenic
1120049354 14:79847238-79847260 GAGGGTGTGGAGATGGAGATTGG - Intronic
1123038902 14:105482507-105482529 GTGGGGGTACAGACGGGGAGCGG - Intergenic
1202847206 14_GL000009v2_random:190064-190086 GAGGGTGTACATTTGTAGAAGGG + Intergenic
1202916669 14_GL000194v1_random:180626-180648 GAGGGTGTACATTTGTAGAAGGG + Intergenic
1202876108 14_KI270722v1_random:2436-2458 GAGGGTGTACATTTGTAGAAGGG - Intergenic
1124258497 15:28165249-28165271 GAGGATGTACAGAGGAAGAAAGG + Intronic
1124356030 15:28995343-28995365 GAGGGTGTGCATATGGGGGTGGG - Intronic
1125156988 15:36598745-36598767 GGGGATGGACAGATGAGGAAAGG - Intronic
1125440330 15:39695288-39695310 CACGGGGTACAGATGGGGATTGG - Intronic
1126467906 15:48977235-48977257 GAGGGTGGGAAGCTGGGGAAGGG - Intergenic
1129206921 15:74042859-74042881 GAGGGTGTACCACTGGGAAAGGG - Intronic
1129238190 15:74236359-74236381 GACGGTGGAGAGATGGGGCAGGG - Exonic
1129535842 15:76313117-76313139 GAGGGCTGTCAGATGGGGAAGGG - Intergenic
1130402965 15:83574309-83574331 AGGGGTGTGCAGGTGGGGAATGG - Intronic
1131145590 15:90009563-90009585 GATGGTGGGCACATGGGGAATGG - Intronic
1131849182 15:96519767-96519789 GAGGGAGAAGAGATGGAGAATGG + Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1132647272 16:1004880-1004902 GAGGGGGTAGAGATGGGGGAGGG + Intergenic
1132647281 16:1004907-1004929 GAGGGAGCAGAGATGGGGGAGGG + Intergenic
1132647287 16:1004925-1004947 GAGGGGGTAGAGATGAGGGAGGG + Intergenic
1132647301 16:1004970-1004992 GAGGGTGTAGAGATGGGGGAGGG + Intergenic
1132647318 16:1005015-1005037 GAGGGGGTAGAGATGGGGGAGGG + Intergenic
1132647334 16:1005059-1005081 GAGGGGGTAGAGATGGGGGAGGG + Intergenic
1132647343 16:1005086-1005108 GAGGGAGCAGAGATGGGGGAGGG + Intergenic
1132647351 16:1005104-1005126 GAGGGGGTAGAAATGGGGGAGGG + Intergenic
1132647379 16:1005176-1005198 GAGGGGGTAGAGATGGGGGGAGG + Intergenic
1133315937 16:4884126-4884148 GAGAGTGTCCAGGTGGAGAAGGG - Exonic
1133519714 16:6545276-6545298 GAGGGGGAAAAGATGGGGAAAGG - Intronic
1134001055 16:10783079-10783101 GAGGGGGTAGTGATTGGGAAGGG + Intronic
1135529163 16:23237916-23237938 GAGGGTGAACAGATTTGGACAGG - Intergenic
1140837406 16:78808070-78808092 GAGAGTCTCCAAATGGGGAAGGG - Intronic
1140996321 16:80263166-80263188 GAGGGTATACAGATGTGGGTGGG - Intergenic
1142310065 16:89307119-89307141 GAAGGCTTACTGATGGGGAAAGG - Intronic
1144035065 17:11357502-11357524 GAGGGGATACACCTGGGGAAGGG - Intronic
1144244068 17:13345871-13345893 CAGGGTGAAGAGAAGGGGAATGG + Intergenic
1144330998 17:14224222-14224244 GAGGGTGTCCACCTGGGGAAGGG - Intergenic
1144603651 17:16643509-16643531 GAGGCTGTAAGGAGGGGGAATGG + Intronic
1144726699 17:17505933-17505955 GAGGGTGTCCAGATGGGACCGGG + Intronic
1144836814 17:18160867-18160889 GAGGTAGTACAGATGGAGACAGG - Intronic
1146028213 17:29341624-29341646 GAGGGTGGTAGGATGGGGAAGGG + Intergenic
1146527031 17:33575819-33575841 GAGGGAGTACAGAGAGGCAAGGG + Intronic
1146597336 17:34181588-34181610 GAGGCTGTGCAGGTGGGGCAGGG + Intergenic
1147363587 17:39946142-39946164 GAGGGTGCAAAGAGGGGCAAGGG + Intergenic
1147459256 17:40557952-40557974 GAGGGAGTGGTGATGGGGAAGGG + Intronic
1149080112 17:52645284-52645306 GAAGGAGCACAGATTGGGAAAGG + Intergenic
1149095868 17:52839778-52839800 GAGTGAATACAGATAGGGAATGG + Intergenic
1151454378 17:74217407-74217429 GAGGGTACACAGTTGGGGACTGG + Intronic
1152340455 17:79721328-79721350 GATGGTGGACAGAGGGAGAAAGG + Intergenic
1153773272 18:8432492-8432514 GAGAGTGGAGAGATGGGGATCGG - Intergenic
1158234607 18:55299768-55299790 GAGGGTCTACTATTGGGGAATGG - Intronic
1158469936 18:57727142-57727164 GAGTGATTACTGATGGGGAAGGG - Intronic
1159084135 18:63768791-63768813 GAGGGAGGACAGATGGCAAAGGG - Intronic
1159919725 18:74216525-74216547 GAGGTTGGAGAGATGGGGAAGGG - Intergenic
1160573199 18:79832346-79832368 GAGGATGGACAGGTGAGGAAGGG - Intergenic
1160613750 18:80109035-80109057 GAGTTTGCACAGATGTGGAAAGG + Exonic
1161105771 19:2443274-2443296 GAGGGTCTCCTGTTGGGGAAGGG + Intronic
1161242430 19:3229775-3229797 GAGGATGCACTGACGGGGAAAGG + Intronic
1162110014 19:8394974-8394996 AAGGCTGTACAGCTGGGGCAAGG + Intronic
1165604948 19:37093817-37093839 GAGGTAGAACAGATGGAGAATGG + Intronic
1165886830 19:39084511-39084533 GGGTGGGTACAGATGGGGGAAGG + Intronic
1167612474 19:50514082-50514104 GAGGGTGTGCTGCAGGGGAAAGG - Intronic
1168559448 19:57370859-57370881 GAGGGTGTAGAGATTGAGGAAGG + Intronic
925667922 2:6281511-6281533 GTGAATGTAGAGATGGGGAAGGG - Intergenic
927282965 2:21326850-21326872 GATGGTGTGTAGATGGGCAATGG - Intergenic
929994370 2:46816272-46816294 GAAGGTGTGCAGGTGCGGAAAGG + Intergenic
930692369 2:54377753-54377775 GAGAGTGTGTAGATGAGGAAAGG + Intronic
931724673 2:65097320-65097342 GGGGGTGTAAAGATGGATAAGGG + Intronic
931816485 2:65908216-65908238 GAGGGTGTACAGCTGGACATGGG - Intergenic
931857136 2:66314748-66314770 GGGCATGTGCAGATGGGGAAAGG - Intergenic
932284689 2:70522278-70522300 GAGGGTGTACAGATGGGGAATGG + Intronic
932454024 2:71834709-71834731 GAGGGTGAACTGAGGGGCAAAGG + Intergenic
932475430 2:72003022-72003044 GAGGGTGTGAACATGGAGAAGGG - Intergenic
932491756 2:72127232-72127254 GAGGGAGAAGAGAGGGGGAAAGG - Intergenic
932585084 2:73022612-73022634 GGGGGTGTAGGGAGGGGGAAGGG + Intronic
932850288 2:75178041-75178063 GAAGGTGGACATATGGGTAAAGG - Intronic
933157234 2:78989868-78989890 TAGGTTGTAGAGTTGGGGAAAGG - Intergenic
934077581 2:88441070-88441092 GAGGGGCTACAGATGGTGAGTGG + Intergenic
934300370 2:91773049-91773071 GAGGGTGGAGGGATGGGAAATGG + Intergenic
935015888 2:99181510-99181532 GAGGCTGGACAGCTTGGGAAAGG + Intronic
935028041 2:99296270-99296292 GGGGTTTTACAGAGGGGGAATGG - Intronic
937025937 2:118697123-118697145 GGAGGGGCACAGATGGGGAAGGG + Intergenic
938072640 2:128316713-128316735 GTGTGTGTACAGTTGGGGGAGGG + Intronic
938869489 2:135460049-135460071 AAGGGTGTAAAGGTGGTGAATGG + Intronic
939117896 2:138081659-138081681 TGGGGTTTACAGATGGGGAAAGG + Intergenic
939962097 2:148574242-148574264 GAGGTTGTACATGTAGGGAAAGG + Intergenic
940013724 2:149081687-149081709 GAGGGTGTAGGGATCAGGAAGGG - Intronic
940840432 2:158573887-158573909 GAGGGTGTGCCCATGGGCAAGGG + Intronic
940874970 2:158889251-158889273 GAGGATATACAGATGGTTAAAGG + Intergenic
940892864 2:159051997-159052019 TAGGGCATACAGCTGGGGAATGG + Intronic
941514452 2:166455544-166455566 GAGGGGGAAGAGAAGGGGAAGGG + Intronic
942308510 2:174632321-174632343 GAAAGTGGAAAGATGGGGAAGGG + Intronic
942659132 2:178245801-178245823 AAGGGTGTACAGCTGGGAAGTGG + Intronic
943057077 2:182995086-182995108 GAGGGTATGCAGATGTGAAAGGG - Intronic
943453539 2:188074980-188075002 GAGTGTGTACCAGTGGGGAAAGG + Intergenic
944033443 2:195265065-195265087 CAGGGTATAGGGATGGGGAAAGG - Intergenic
944151378 2:196562220-196562242 GAGGGTTTAAAGCTGGGAAAGGG - Intronic
945673984 2:212833220-212833242 GAGCTTGTGCGGATGGGGAACGG - Intergenic
946068427 2:217010195-217010217 GAGAGTGTAAAGAAGGTGAAAGG - Intergenic
946203701 2:218088201-218088223 GAGGGAGTGAAGGTGGGGAATGG + Intronic
947442843 2:230138253-230138275 GATGGGGTACAGGTGGGGAGGGG + Intergenic
947665174 2:231900928-231900950 GCTGGTATACAGGTGGGGAAAGG - Intergenic
947983135 2:234426719-234426741 GAGTGTCAACAGATGGGGGAGGG + Intergenic
948458622 2:238118689-238118711 GAGGGTGGATAGAGGAGGAATGG + Intronic
1168748689 20:266877-266899 GAGGGAGTAGAAATGGGGACAGG + Intergenic
1168894444 20:1313566-1313588 GTGGGGGTAGGGATGGGGAAAGG + Intronic
1170073435 20:12393255-12393277 GAGGATGGACAGAGAGGGAAAGG + Intergenic
1170882372 20:20308418-20308440 AAAGGTGTACAGATGGGGAAGGG + Intronic
1171135148 20:22688853-22688875 CAGCATGCACAGATGGGGAAAGG - Intergenic
1171225686 20:23440256-23440278 GAGGCTGTAGACATGGGGATCGG + Exonic
1171878142 20:30597554-30597576 GAGGGTGTGGACATGGGGCATGG - Intergenic
1172958764 20:38782179-38782201 CAGGGTGTAAAGATGGTGCAGGG + Intergenic
1173429566 20:42974249-42974271 TGGGGAGTTCAGATGGGGAATGG - Intronic
1174114135 20:48215332-48215354 GAGTGTGTACAGGTGGGACAGGG - Intergenic
1174806482 20:53608221-53608243 GAGGGTGTTCAGAGCAGGAAAGG + Intronic
1175319927 20:58078441-58078463 GAGGGAGTAGAGTTGGGAAAGGG + Intergenic
1175627445 20:60500918-60500940 GAGGTTATGCAGATGGGGAAAGG + Intergenic
1175872961 20:62217037-62217059 GAGGGAGGACAGGAGGGGAAAGG - Intronic
1176636023 21:9195273-9195295 GAGGGTGTACATTTGTAGAAGGG + Intergenic
1177462329 21:21429286-21429308 CAGGGTGCACAGTTGGTGAATGG + Intronic
1178708759 21:34895905-34895927 GAGGGAGTAGAGATGAGGAGTGG + Intronic
1179308075 21:40172965-40172987 GCTGGTGCCCAGATGGGGAAAGG + Intronic
1179365004 21:40750868-40750890 GATGGTGTGGACATGGGGAAAGG - Intronic
1179714917 21:43281642-43281664 GAGGGTGTAGAGATGAAAAAGGG + Intergenic
1180063673 21:45402415-45402437 GAGGTGGTACAGACAGGGAAGGG - Intergenic
1180282358 22:10714192-10714214 GAGGGTGTACTATTGTGGAAGGG + Intergenic
1180614354 22:17118275-17118297 GAGGAAGGACAGGTGGGGAATGG + Exonic
1180655039 22:17413141-17413163 GAGGGTTATCTGATGGGGAATGG + Intronic
1180665940 22:17512189-17512211 GAGGATGTAGAGCTGGGCAACGG + Intronic
1180800098 22:18627693-18627715 GAGGGTGTGCACAAGGGGCAGGG - Intergenic
1180851331 22:19023258-19023280 GAGGGTGTGCACAAGGGGCAGGG - Intergenic
1181221617 22:21367573-21367595 GAGGGTGTGCACAAGGGGCAGGG + Intergenic
1181487715 22:23241964-23241986 AAGGGGGTACAGCTGGGAAAGGG - Intronic
1181534350 22:23533995-23534017 GAGGGTGGGGAGATGAGGAAGGG + Intergenic
1181851871 22:25755153-25755175 GAGGGTGGACAAAAGGGGAGAGG - Intronic
1182586456 22:31346590-31346612 GGGGGTGTATAAATAGGGAAGGG - Intergenic
1183086933 22:35492177-35492199 GAGGGAGTACACCTGGGGGAGGG - Intergenic
1183324967 22:37186289-37186311 GAGGGTGTGCAGCTTGGCAAGGG + Intronic
1183689730 22:39381938-39381960 GAGAGGGGACAGATGGGGAGGGG - Exonic
950565348 3:13766688-13766710 GAGGGAGTGAAGATGGGGACGGG - Intergenic
951484335 3:23194789-23194811 GAAGGTTCACAGAAGGGGAAGGG + Intergenic
953927198 3:46988509-46988531 GAGGGTGTGGAGAAGGGGAGTGG - Intronic
955107049 3:55908472-55908494 GAGAGTGAACAGAGGAGGAAAGG + Intronic
955596802 3:60600000-60600022 AAATGTGTTCAGATGGGGAAAGG + Intronic
956712148 3:72048295-72048317 GAGGATGTTGAGATGGGGAAGGG + Intergenic
956967200 3:74475530-74475552 AAGGCTGTACTTATGGGGAAAGG + Intronic
957103505 3:75857236-75857258 GAGGGTGTACAGTTGTAGAAGGG + Intergenic
957110281 3:75946896-75946918 GAGGGTGTACTCTTGTGGAAGGG + Intronic
958721007 3:97843431-97843453 GAGTCTGGACAGGTGGGGAAAGG + Intronic
958792312 3:98666019-98666041 GAGGTTGTAGAGATGGTCAAAGG - Intergenic
959220027 3:103506561-103506583 GGGGGTGTACGAATGGGGAGTGG + Intergenic
959819620 3:110717612-110717634 GTGTGTGTGCAGTTGGGGAAGGG + Intergenic
960947038 3:122974012-122974034 CAGGGTGTACATTCGGGGAACGG - Intronic
961864790 3:129945781-129945803 GAGGGCGTACTGGTGGGCAAGGG - Intergenic
962120966 3:132559473-132559495 GGAGATGGACAGATGGGGAATGG + Intronic
962862249 3:139414830-139414852 CAGGGTGAGCAGATGGGGAGGGG - Intergenic
964642214 3:158921025-158921047 GAGGGTGGAGAGATGGAGAGAGG - Intergenic
965322839 3:167269012-167269034 GAGGTGTTACAGATGTGGAAGGG + Intronic
967309645 3:188093897-188093919 CAGGGTGTAGGGATGGGCAAGGG + Intergenic
968752405 4:2396825-2396847 GAGGGCGGACAGCTGGGGGAGGG + Intronic
968928105 4:3560607-3560629 GTGGATGGACAGATGGGGAATGG - Intergenic
968930983 4:3578646-3578668 GTATGTGTACAGATGGGCAAAGG - Intronic
969028543 4:4193338-4193360 GTGGGTGTGGTGATGGGGAAGGG - Intronic
969523045 4:7689909-7689931 GATGATGGACAGATGGTGAATGG + Intronic
969798933 4:9547466-9547488 GTGGGTGGACAGATGGGTAGGGG - Intergenic
971001900 4:22332701-22332723 GAGGGGATACAGTTGGGGAAGGG - Intergenic
971221583 4:24712545-24712567 GATGGTGAAAGGATGGGGAAGGG + Intergenic
971265402 4:25092385-25092407 GAGGCTGTGCAGATGGGAACAGG - Intergenic
971332241 4:25691453-25691475 GGGGGTGTACAAATAGGGAGTGG + Intergenic
971357042 4:25904479-25904501 GTGTGGGTATAGATGGGGAATGG + Intronic
973176167 4:47208324-47208346 GAGGCTGAAGAGATGGGGAATGG + Intronic
975745459 4:77470641-77470663 GGGGCTGTGCAGATGGGGATGGG + Intergenic
976654128 4:87469578-87469600 GAGGGTGTACTCACGGGGATGGG + Intergenic
976834690 4:89357805-89357827 GAGAGTGAACTGATGGAGAAAGG - Intergenic
982445640 4:155487624-155487646 GCTGCTGTACTGATGGGGAATGG + Intergenic
983745865 4:171199430-171199452 GAGGGTGGAGAGAGGGAGAAGGG - Intergenic
984784408 4:183554326-183554348 GAGGGTGTGTGGATGGGGGAGGG + Intergenic
985842555 5:2319488-2319510 GAGCCTGAACAGATGGGAAAAGG - Intergenic
985933475 5:3077702-3077724 AAGGGAGTACAGAGTGGGAAAGG + Intergenic
986041871 5:4001376-4001398 CAGGGAGTACAGCTGGGGGAAGG + Intergenic
986225006 5:5804215-5804237 AATGGTGTACAGAGAGGGAATGG - Intergenic
986491857 5:8301011-8301033 GAGGCTGTACAGAAGGGAAGGGG + Intergenic
986706555 5:10458568-10458590 GATGGTGTACATAGGGGGGATGG - Intronic
987086498 5:14474421-14474443 GTGGGTGTGCAGATGAAGAATGG - Intronic
988299770 5:29406789-29406811 GAGGGAGAAGAAATGGGGAAAGG + Intergenic
990498032 5:56368104-56368126 AAGGGTGGGGAGATGGGGAATGG - Intergenic
991446302 5:66703453-66703475 GGGGGTGTAGGGATAGGGAATGG + Intronic
991633012 5:68675530-68675552 AAGAGTGAACAAATGGGGAAGGG - Intergenic
992212234 5:74492389-74492411 GTAGATGTAAAGATGGGGAAAGG - Intergenic
992538425 5:77736665-77736687 GAGGAGGTAGAGATAGGGAAGGG - Intronic
994688248 5:102983581-102983603 GAAAGTGTAGAGATGGGCAAAGG + Intronic
995271237 5:110221615-110221637 GAGGGAGAAGAGATGGGGAAAGG - Intergenic
997352118 5:133238635-133238657 GAGTGTGCACACATGGGGGAGGG + Intronic
998031046 5:138868344-138868366 CAGTGAGTACAGATGGGAAAAGG - Intronic
998617009 5:143751844-143751866 GAGGGGGCACAGCTAGGGAAAGG + Intergenic
998855420 5:146390312-146390334 GAGGATGTTCAGAAGGGGAGGGG - Intergenic
999071797 5:148750812-148750834 CAGAGTGCAGAGATGGGGAAAGG + Intergenic
1003294144 6:4809029-4809051 GAGGGCGTACAGAATGGGAATGG - Intronic
1004521745 6:16367248-16367270 GAGGGGGCAGAGATGGGAAAGGG + Intronic
1004810579 6:19256618-19256640 GAGGGTGTAAAGATATGGAGAGG + Intergenic
1004831053 6:19476876-19476898 GAGGGGGTATAGAGGAGGAATGG + Intergenic
1006400402 6:33814121-33814143 GATGGGGCACAGCTGGGGAAGGG - Intergenic
1007279257 6:40698386-40698408 GAAGGTGTACAGATGGGCTTGGG - Intergenic
1010191578 6:73201964-73201986 GATGCTGTAGATATGGGGAAGGG - Intergenic
1010452708 6:76020527-76020549 GAGGTTGTAATGAAGGGGAAAGG + Intronic
1011988052 6:93475079-93475101 GAGGCTGTACAAATTTGGAAGGG + Intergenic
1012429158 6:99146098-99146120 GAGAGGGTACAGATGGGGTATGG + Intergenic
1013431332 6:110057897-110057919 AAGAGTGTAAAGATGGGGAGGGG - Intergenic
1014486601 6:122006888-122006910 AGGTGTGTTCAGATGGGGAAAGG + Intergenic
1016430858 6:143983776-143983798 GTGGGAGGACAGATGGAGAATGG + Intronic
1018341226 6:162852961-162852983 GACGGTGTTGAGAAGGGGAATGG - Intronic
1018485313 6:164235694-164235716 GACTGTGGACAGATGGGGAAAGG - Intergenic
1018885920 6:167937106-167937128 GAGTGTGTACAGAAGGTGCAGGG + Intronic
1019067564 6:169315118-169315140 GAGTGTGCAGAGATGGGGATTGG - Intergenic
1019070600 6:169341833-169341855 GAGGGTGCACAGATGGAGCCGGG - Intergenic
1019625244 7:2012599-2012621 GAGGATGGACAGAGGGGGCAGGG + Intronic
1020446523 7:8274538-8274560 AAGGTTGTACAGATGTGGATGGG + Intergenic
1020535388 7:9389820-9389842 GGGGGTGTAGAGATGGGGGGTGG + Intergenic
1021950511 7:25769569-25769591 GAGGGAGGAAAGAAGGGGAAGGG + Intergenic
1029625796 7:101719364-101719386 GAGGGAGGACAGATGGGGAGGGG + Intergenic
1030776952 7:113545674-113545696 GTGTGTGTTCAGATGGTGAAGGG + Intergenic
1033130281 7:138740124-138740146 GAGAGGGGACAGAAGGGGAAAGG + Intronic
1034971833 7:155424105-155424127 GAGGGTGTCCTGGAGGGGAACGG - Intergenic
1035136491 7:156708738-156708760 CAGTGTGGGCAGATGGGGAAGGG + Intronic
1035564996 8:635484-635506 GAGGGAGGACAGGTGGGGACTGG - Intronic
1035580136 8:734644-734666 CAAGGTATACAGATTGGGAAGGG + Intronic
1036226743 8:6965473-6965495 AAGGTTGTAAACATGGGGAATGG + Intergenic
1038199138 8:25395632-25395654 GAGGGTGCACAGAGAGGGACCGG - Exonic
1038865042 8:31430357-31430379 AAGGGAGGACAGGTGGGGAAAGG + Intergenic
1039644644 8:39267221-39267243 GAGGCTGTGCTGGTGGGGAAAGG + Intronic
1040276085 8:46014359-46014381 GAGAGTGTACAAATAGGGTATGG + Intergenic
1040818102 8:51529938-51529960 TTGGTTGTACAGCTGGGGAAGGG - Intronic
1041210475 8:55545495-55545517 GAGGGTGTACAAATAGGGAGTGG - Intergenic
1041412812 8:57575269-57575291 GAGGCTGGACAGAAGAGGAAAGG + Intergenic
1041896177 8:62926933-62926955 GAGGGAGTAAAGTTGGGGGAGGG - Intronic
1043865048 8:85365033-85365055 GTGGGTGGTCAGATGGGGCAGGG + Intronic
1045138516 8:99251136-99251158 AAAGGTATACAGATGGGAAATGG - Intronic
1045402999 8:101837264-101837286 GTGGGTTTACAGATCAGGAATGG - Intronic
1045726362 8:105178477-105178499 GAGGTTGTATAGAAGGAGAAAGG - Intronic
1048365125 8:133731790-133731812 GAGGGTGTGCAGAGGAGGAAAGG + Intergenic
1048773440 8:137919921-137919943 GAGGGTGTCCACATAAGGAAAGG - Intergenic
1048781068 8:138001674-138001696 GAAGGTGTAGGGATGGAGAAGGG + Intergenic
1048946867 8:139456776-139456798 GAGGTTGTAGTGATGGGGAAAGG - Intergenic
1049166596 8:141129432-141129454 GAGGGTGCAGAGATGGAGGAAGG - Intronic
1049285905 8:141775074-141775096 CCGTGTGAACAGATGGGGAAGGG + Intergenic
1049359893 8:142207417-142207439 GTGGGTGGATGGATGGGGAATGG + Intergenic
1049359921 8:142207522-142207544 GTGGGTGGATTGATGGGGAATGG + Intergenic
1049718629 8:144105308-144105330 GTGGGCGTGGAGATGGGGAATGG + Intronic
1050306240 9:4308496-4308518 GAGGGTGTTCAGGTGGGAGATGG - Intronic
1053150082 9:35737715-35737737 GATGGTGGAGAGATGGGAAAAGG + Intronic
1053180722 9:35966780-35966802 CAGGGGTTACAGATGGGGAAGGG - Intergenic
1053311550 9:37023980-37024002 GAGGGTTCACAGAAGGGGAGAGG - Intronic
1054459139 9:65453300-65453322 GTATGTGTACAGATGGGTAAAGG + Intergenic
1057266894 9:93623079-93623101 GAGGGTGTGGACATGGGGCATGG + Intronic
1057280539 9:93708193-93708215 GAGGGTGGCCAGCTGGGTAATGG + Intergenic
1057810617 9:98254164-98254186 AGGGGTGGACAGATGGGGATGGG + Intronic
1057846597 9:98530909-98530931 GTGTGTGTATAGAGGGGGAAGGG + Intronic
1060152675 9:121298881-121298903 GAGGGTGGAGGGATGGGGATGGG + Intronic
1060208181 9:121694745-121694767 AAGGGTGTCCAGATGGGCAATGG + Intronic
1060484203 9:124036943-124036965 GAAGGTGATCAGATGGAGAAGGG + Intergenic
1061169096 9:128941691-128941713 TTAGGTGTACAGTTGGGGAAAGG - Exonic
1061255698 9:129453469-129453491 GAGGGTAGAGGGATGGGGAATGG + Intergenic
1061255778 9:129453698-129453720 GGGGATGGAGAGATGGGGAATGG + Intergenic
1061255791 9:129453736-129453758 GAAGATGGAGAGATGGGGAATGG + Intergenic
1061627812 9:131851852-131851874 GAGGTTGAACATGTGGGGAAGGG + Intergenic
1062115873 9:134808234-134808256 GAGGGTGTGCACATTGGGAAGGG - Intronic
1062252710 9:135606317-135606339 GAAGGTGTGCAGATGGGGTGGGG + Intergenic
1062646466 9:137550880-137550902 GAGGGGGTGCAGCTGGGGAGGGG + Intergenic
1062646489 9:137550933-137550955 GAGGGGGTGCAGCTGGGGAGGGG + Intergenic
1062646512 9:137550986-137551008 GAGGGGGTGCAGCTGGGGAGGGG + Intergenic
1062646535 9:137551039-137551061 GAGGGGGTGCAGCTGGGGAGGGG + Intergenic
1062646548 9:137551075-137551097 GTGGGGGTACCGCTGGGGAAGGG + Intergenic
1203652370 Un_KI270751v1:138857-138879 GAGGGTGTACATTTGTAGAAGGG + Intergenic
1186220951 X:7348892-7348914 GAGGGATTACAAATGGGGAATGG - Intronic
1186445286 X:9622285-9622307 GGGGGTGTGGAGATGGGGGATGG - Intronic
1186524741 X:10238212-10238234 CTGGGGGTACAGCTGGGGAAAGG + Intergenic
1186565647 X:10659375-10659397 GAAGGGGAACAGATGAGGAAAGG + Intronic
1187420913 X:19132988-19133010 TTGAGTGTACAGATGGGCAAAGG - Intergenic
1187668397 X:21641902-21641924 GTGGGAGAACAGAAGGGGAAAGG + Intronic
1187792837 X:22969756-22969778 GAGGGTTTGGTGATGGGGAAAGG - Intergenic
1188476407 X:30597509-30597531 CAGGGTGTACAGTTAGGGACAGG - Intergenic
1189061439 X:37757529-37757551 AAGGGTGTACATTTAGGGAAGGG - Intronic
1189422442 X:40868183-40868205 GAGGGTGGGGAGATGGGGTATGG - Intergenic
1189577987 X:42375614-42375636 AAGGGTGTCCAGATGGGCAGTGG - Intergenic
1190291750 X:48997620-48997642 GAGGAAGTAGAGATGGGGAAAGG + Intronic
1190755280 X:53396109-53396131 GATGGTGGGCAGATGGTGAAGGG - Intronic
1192205560 X:69093767-69093789 GAGGTTGAGCATATGGGGAAGGG + Intergenic
1192423481 X:71054420-71054442 GTGTGTGTAGAGATGGGGGAGGG - Intergenic
1192538978 X:71952351-71952373 GAGTGTTTACAGTTGGAGAAGGG + Intergenic
1192545100 X:72006548-72006570 GAGGGTGCACAGAGGTGGGAAGG - Intergenic
1192725180 X:73742906-73742928 GAGGGTGGAGAGAGGGAGAAGGG - Intergenic
1192979122 X:76319535-76319557 GAGGGTGTCCAGATGAGCAGGGG - Intergenic
1192987504 X:76415723-76415745 GGTGATGTACAGATGGGGTATGG - Intergenic
1193434955 X:81461804-81461826 GAGGGTGGAGAGTTGGGGAAGGG + Intergenic
1193750461 X:85336585-85336607 GAAGGTGTACAAATGGCAAACGG - Intronic
1195058357 X:101168734-101168756 GAGGCTATACAGTGGGGGAATGG + Intergenic
1196287068 X:113895482-113895504 GAGGGAGGACAGAAGGGGAGAGG - Intergenic
1197226462 X:123960732-123960754 GAGGGTGTAAAGAAGAGGAAGGG + Exonic
1197727058 X:129783332-129783354 GTGGGAGTGCAGAGGGGGAAGGG - Intronic
1198390324 X:136167669-136167691 GAAGGGCTACAGGTGGGGAAAGG - Intronic
1199342847 X:146702367-146702389 GAGGGTGTACGGAGGGGGCAAGG - Intergenic
1199874628 X:151920564-151920586 TAGGGAGTGCAGATGGGAAAGGG - Intronic
1199874632 X:151920582-151920604 ATGGGGGTACAGATGGGGTAGGG - Intronic