ID: 932284971

View in Genome Browser
Species Human (GRCh38)
Location 2:70524493-70524515
Sequence GAGTATCGCCGAGCCCTCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 32
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 31}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932284964_932284971 12 Left 932284964 2:70524458-70524480 CCATCCAAATTCCTGGAATTTCA 0: 1
1: 0
2: 42
3: 1595
4: 36940
Right 932284971 2:70524493-70524515 GAGTATCGCCGAGCCCTCTCGGG 0: 1
1: 0
2: 0
3: 0
4: 31
932284968_932284971 1 Left 932284968 2:70524469-70524491 CCTGGAATTTCAAGGCAACAGGG 0: 1
1: 0
2: 1
3: 40
4: 564
Right 932284971 2:70524493-70524515 GAGTATCGCCGAGCCCTCTCGGG 0: 1
1: 0
2: 0
3: 0
4: 31
932284961_932284971 15 Left 932284961 2:70524455-70524477 CCCCCATCCAAATTCCTGGAATT 0: 1
1: 0
2: 1
3: 49
4: 891
Right 932284971 2:70524493-70524515 GAGTATCGCCGAGCCCTCTCGGG 0: 1
1: 0
2: 0
3: 0
4: 31
932284966_932284971 8 Left 932284966 2:70524462-70524484 CCAAATTCCTGGAATTTCAAGGC 0: 1
1: 0
2: 0
3: 45
4: 548
Right 932284971 2:70524493-70524515 GAGTATCGCCGAGCCCTCTCGGG 0: 1
1: 0
2: 0
3: 0
4: 31
932284963_932284971 13 Left 932284963 2:70524457-70524479 CCCATCCAAATTCCTGGAATTTC 0: 1
1: 0
2: 2
3: 35
4: 324
Right 932284971 2:70524493-70524515 GAGTATCGCCGAGCCCTCTCGGG 0: 1
1: 0
2: 0
3: 0
4: 31
932284962_932284971 14 Left 932284962 2:70524456-70524478 CCCCATCCAAATTCCTGGAATTT 0: 1
1: 1
2: 15
3: 105
4: 566
Right 932284971 2:70524493-70524515 GAGTATCGCCGAGCCCTCTCGGG 0: 1
1: 0
2: 0
3: 0
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932284971 Original CRISPR GAGTATCGCCGAGCCCTCTC GGG Intronic
902323767 1:15684878-15684900 GAGGGTCGCTGACCCCTCTCCGG - Intronic
904397807 1:30234369-30234391 GAGTCTGGCCGGTCCCTCTCTGG + Intergenic
906291912 1:44624984-44625006 GTGTAATGCCGAGGCCTCTCAGG + Intronic
917307102 1:173638220-173638242 GAGAATCGGCGAGACATCTCTGG + Intronic
1086641924 11:89169285-89169307 GAGTCTCTCTGAGCCTTCTCTGG - Intergenic
1089065172 11:115657121-115657143 GTGTATCTCAGAGCCCTCCCTGG - Intergenic
1096614132 12:52822117-52822139 GGGTCTCCCCCAGCCCTCTCTGG - Intronic
1100844606 12:98645418-98645440 GAGTAGCGCCGGGCTCCCTCCGG + Exonic
1113821992 13:113221265-113221287 GAGTATCCCAGAGTCCTCACAGG + Intronic
1114252814 14:20976022-20976044 GAGTCTCTCTGAGCCCACTCTGG + Intergenic
1125431021 15:39593555-39593577 GAGTATCCCTGAGCCCTCGTGGG - Exonic
1129793804 15:78360956-78360978 GAGTGTATCCGAGCCCTCCCAGG - Intergenic
1130166151 15:81461125-81461147 GAGAATGGCCCTGCCCTCTCTGG - Intergenic
1132676118 16:1121926-1121948 GCCCCTCGCCGAGCCCTCTCGGG + Intergenic
1143519379 17:7436961-7436983 GAGTGGCTCCGAGCCCCCTCGGG - Exonic
1157149013 18:45195947-45195969 GAGTATCCCTGAGCCTACTCTGG - Intergenic
1164182263 19:22829948-22829970 GAGTATCTCTGAGCCTACTCTGG + Intergenic
927157140 2:20226917-20226939 GAGAATCGCCTCGACCTCTCGGG + Intergenic
932284971 2:70524493-70524515 GAGTATCGCCGAGCCCTCTCGGG + Intronic
1181368989 22:22401477-22401499 GAGTGTAGCAGGGCCCTCTCTGG + Intergenic
1185027617 22:48424728-48424750 GAGCATTGCTGAGACCTCTCAGG + Intergenic
956427813 3:69154949-69154971 GAGAACCGCAGAGCTCTCTCTGG - Intergenic
963894241 3:150668329-150668351 GAGTATCAAGGAGCCATCTCAGG + Intronic
966241773 3:177762018-177762040 GAGTATTGCAGAGCCCTTGCTGG + Intergenic
970065345 4:12087554-12087576 GAGGATCACCGAGCTCTCTGGGG + Intergenic
985765509 5:1777420-1777442 GAGAAAAGCCGCGCCCTCTCCGG + Intergenic
987328004 5:16829783-16829805 GGGTATCACCGAGGCCTTTCTGG - Intronic
992801400 5:80299344-80299366 GAGAATGGCCCAGTCCTCTCCGG - Intergenic
994610050 5:102024630-102024652 GAGTATCACCGGGGCCTGTCAGG + Intergenic
998253639 5:140568770-140568792 GAGTCAAGCCCAGCCCTCTCTGG - Exonic
1017847900 6:158275382-158275404 GAATATGGCCAAACCCTCTCAGG - Intronic
1048279314 8:133093489-133093511 GTGTATCTCCCAGCCCTTTCTGG + Intronic