ID: 932286063

View in Genome Browser
Species Human (GRCh38)
Location 2:70532799-70532821
Sequence TGCTGTTCCCTGATTGTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 142}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932286059_932286063 4 Left 932286059 2:70532772-70532794 CCAGAGGAGCCAAAAACAGCCAG 0: 1
1: 0
2: 4
3: 14
4: 196
Right 932286063 2:70532799-70532821 TGCTGTTCCCTGATTGTAGGTGG 0: 1
1: 0
2: 1
3: 15
4: 142
932286056_932286063 7 Left 932286056 2:70532769-70532791 CCCCCAGAGGAGCCAAAAACAGC 0: 1
1: 0
2: 0
3: 16
4: 214
Right 932286063 2:70532799-70532821 TGCTGTTCCCTGATTGTAGGTGG 0: 1
1: 0
2: 1
3: 15
4: 142
932286058_932286063 5 Left 932286058 2:70532771-70532793 CCCAGAGGAGCCAAAAACAGCCA 0: 1
1: 1
2: 1
3: 18
4: 222
Right 932286063 2:70532799-70532821 TGCTGTTCCCTGATTGTAGGTGG 0: 1
1: 0
2: 1
3: 15
4: 142
932286053_932286063 26 Left 932286053 2:70532750-70532772 CCTGCTTTAGGCAGTTCCTCCCC 0: 1
1: 0
2: 0
3: 17
4: 171
Right 932286063 2:70532799-70532821 TGCTGTTCCCTGATTGTAGGTGG 0: 1
1: 0
2: 1
3: 15
4: 142
932286052_932286063 27 Left 932286052 2:70532749-70532771 CCCTGCTTTAGGCAGTTCCTCCC 0: 1
1: 0
2: 1
3: 15
4: 212
Right 932286063 2:70532799-70532821 TGCTGTTCCCTGATTGTAGGTGG 0: 1
1: 0
2: 1
3: 15
4: 142
932286055_932286063 10 Left 932286055 2:70532766-70532788 CCTCCCCCAGAGGAGCCAAAAAC 0: 1
1: 0
2: 1
3: 11
4: 174
Right 932286063 2:70532799-70532821 TGCTGTTCCCTGATTGTAGGTGG 0: 1
1: 0
2: 1
3: 15
4: 142
932286060_932286063 -5 Left 932286060 2:70532781-70532803 CCAAAAACAGCCAGAAAGTGCTG 0: 1
1: 0
2: 0
3: 24
4: 224
Right 932286063 2:70532799-70532821 TGCTGTTCCCTGATTGTAGGTGG 0: 1
1: 0
2: 1
3: 15
4: 142
932286057_932286063 6 Left 932286057 2:70532770-70532792 CCCCAGAGGAGCCAAAAACAGCC 0: 1
1: 0
2: 0
3: 29
4: 234
Right 932286063 2:70532799-70532821 TGCTGTTCCCTGATTGTAGGTGG 0: 1
1: 0
2: 1
3: 15
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932286063 Original CRISPR TGCTGTTCCCTGATTGTAGG TGG Intronic
900874277 1:5330641-5330663 TGCAGCTCCCTGAGAGTAGGAGG - Intergenic
902072825 1:13755379-13755401 TGCTGTGCCCTATTTTTAGGTGG + Intronic
908439293 1:64137311-64137333 TGCTGTGCCCTGTATGTATGTGG + Intronic
912764372 1:112395873-112395895 TGCTTTTACCTGACTGTACGCGG - Intergenic
913007014 1:114643982-114644004 TGCTGTTTACTGATTGTAACGGG + Intronic
913664728 1:121036876-121036898 TGCTGTCTCCTGATGGTAGGTGG - Intergenic
914016121 1:143820151-143820173 TGCTGTCTCCTGATGGTAGGTGG - Intergenic
914161661 1:145140857-145140879 TGCTGTCTCCTGATGGTAGGTGG + Intergenic
914654740 1:149728692-149728714 TGCTGTCTCCTGATGGTAGGTGG - Intergenic
920185065 1:204154360-204154382 TGGTGTTCTATGATTTTAGGTGG + Intergenic
924270416 1:242326428-242326450 TCCTGGTCCCTGTTTGTACGTGG + Intronic
1064773850 10:18753513-18753535 TCCTGTTCCATGGTTGTATGGGG - Intergenic
1065476533 10:26144271-26144293 TTGTGTTCCCTGATGATAGGAGG + Intronic
1066320226 10:34295643-34295665 TGCTTTTCCCTGGCTGCAGGTGG + Intronic
1066783556 10:38978337-38978359 TCCTGGTCCCTGTTTGTATGTGG + Intergenic
1070828461 10:79404555-79404577 TGCTGTTTGCTGATTGCTGGAGG + Intronic
1071229233 10:83565305-83565327 TGGTGTTGCCTGATTGGCGGCGG - Intergenic
1076699018 10:132260616-132260638 TGCTGGCCCCTGCTTGCAGGTGG - Intronic
1077010870 11:378777-378799 TCCTGATCCCTGAGTGGAGGAGG - Intronic
1077189880 11:1251480-1251502 AGCTGTTCCCAGAGTGGAGGAGG - Exonic
1081572043 11:44297864-44297886 TGCTGTTTCCTGAGTCTAGAGGG + Intronic
1090127265 11:124100239-124100261 TGATGTTCCCTGAAGGTAGAAGG + Intergenic
1097016814 12:55993053-55993075 TGCTGTGATCTGATTGGAGGAGG + Exonic
1097176256 12:57145147-57145169 TGCTGTTCCCTGGTGGGTGGTGG + Intronic
1099520205 12:83650670-83650692 TATAGTTCCCTGATTGTAGCAGG - Intergenic
1100103286 12:91136965-91136987 TGCTTTTTCCTGATCTTAGGGGG + Intergenic
1103721701 12:122978832-122978854 TGCTGTACCCTGACTGTGGCGGG + Exonic
1106004253 13:25753726-25753748 TGTTGCTCCCTGATTGTGGAAGG + Intronic
1107586150 13:41850392-41850414 TCCTGGTCCCTGAGTCTAGGGGG - Intronic
1108570915 13:51750201-51750223 TGATGTTCTGTGATTTTAGGAGG + Intronic
1110345637 13:74444508-74444530 TGCTGCTCCCTGATTGATGTAGG - Intergenic
1110770889 13:79344319-79344341 TTTTGATCCCTGATTCTAGGAGG - Exonic
1111202577 13:84959869-84959891 TGCATTTCCCTGATTATAGTGGG + Intergenic
1113164844 13:107428546-107428568 GGCTGTTTCCTGATTCTGGGAGG - Intronic
1116228770 14:42188322-42188344 TGATGGTCCCTGATTCTAGATGG + Intergenic
1118692231 14:68351255-68351277 TGCTGTTCCCTTAGTCTAGCAGG - Intronic
1119087409 14:71750922-71750944 TGCCCTTCCCTGTTTGGAGGTGG + Intergenic
1120610443 14:86635252-86635274 TGTTGTTATCTGATTGGAGGTGG - Intergenic
1122839831 14:104451757-104451779 GGCTGGTCTCTGAGTGTAGGTGG + Intergenic
1124373620 15:29116995-29117017 TGCTTTCACCTGATTGTGGGAGG + Intronic
1124532842 15:30521830-30521852 TGCTGTTCATTGATTGAGGGAGG - Intergenic
1124846179 15:33293171-33293193 TGCTATTGCCTCATTGCAGGCGG + Intergenic
1125335487 15:38622462-38622484 TGCATTTCCCTGATGGTAGGAGG + Intergenic
1128481657 15:68045498-68045520 TGCTGCTCCCTGCTGGCAGGTGG - Intergenic
1128921034 15:71610391-71610413 TGCAGTTCCCTGGATGAAGGTGG - Intronic
1129113543 15:73352353-73352375 AGTTCTTCCCTGATTGTCGGAGG - Intronic
1134371857 16:13633337-13633359 TGCTTTTCCCAGCTTCTAGGAGG - Intergenic
1137667283 16:50259015-50259037 TGCTTTTTCTTGATTGTAGCTGG + Intronic
1139700493 16:68705096-68705118 TGCTGCTTCCTGATCGTATGTGG - Intronic
1140315468 16:73892129-73892151 TGCTGCTCCCTGGTTGCAGAGGG + Intergenic
1140625706 16:76791956-76791978 TGCTGCTACCTGATTGCAAGTGG - Intergenic
1142068264 16:88074856-88074878 TACTGTTCCCTGGATGGAGGAGG - Intronic
1143632881 17:8148838-8148860 TGCTGTGACCTTATTGTTGGAGG - Intronic
1146924062 17:36732069-36732091 TCTTGTTCCCTCATTGTTGGTGG - Intergenic
1147515599 17:41114677-41114699 TGCAGTCCCCTGCTTGTGGGAGG - Intergenic
1150834687 17:68553526-68553548 TGCTGTGACCTGGTTATAGGTGG - Intronic
1151775061 17:76195203-76195225 TGCTCTACCCCGCTTGTAGGAGG - Intronic
1151811146 17:76442808-76442830 CGCTGTTCACTGGTTGAAGGAGG + Intronic
1151934338 17:77252905-77252927 TGCTGTGCCATGATTTTGGGTGG + Intergenic
1152126846 17:78452088-78452110 TGCTGTCCCCTCTTTGTAGCTGG + Intronic
1156327175 18:36085246-36085268 CGCTGGTCCCTGATTCTAGCTGG - Intergenic
1163363359 19:16862017-16862039 TGATGTTCCCTGACTGGAAGAGG - Intronic
1165398096 19:35578412-35578434 TGCATTTCCCTGATTGCTGGTGG - Intergenic
926307198 2:11646900-11646922 TGGTGTTCCCTGCATGTAGGAGG + Intergenic
927029226 2:19103365-19103387 CTCTGTTCCCTGATTGCTGGGGG - Intergenic
927395761 2:22649655-22649677 TTCTGTTTCCTGATTGTACCTGG - Intergenic
928895713 2:36260520-36260542 TTCAGTTCCATGATTGTGGGGGG - Intergenic
929916349 2:46139109-46139131 TGGTGGTCCCTGATTTTAGGAGG - Intronic
930800024 2:55434152-55434174 TGGTGTTCACTGCTTGTTGGTGG + Intergenic
931702341 2:64919139-64919161 TGCTGTTTCCTATTTCTAGGGGG - Intergenic
932007940 2:67946333-67946355 TGCTGTCCCCTGATAGAAGGAGG - Intergenic
932286063 2:70532799-70532821 TGCTGTTCCCTGATTGTAGGTGG + Intronic
932632211 2:73354771-73354793 TGGTGTTCACTGCTTGTAGTTGG - Intergenic
934522297 2:95026888-95026910 TGTTATTGCCTGATTGGAGGGGG + Intronic
939451843 2:142384711-142384733 TTCTGATCCCTGATTAGAGGAGG - Intergenic
941096368 2:161243014-161243036 TGCTCTTCCCTCATTGGAGCAGG - Intergenic
943539728 2:189197510-189197532 TGCTATTCCCTGTTTCTGGGTGG + Intergenic
944713529 2:202357255-202357277 TGGTGATCCCTGCTTCTAGGTGG + Intergenic
944981371 2:205124436-205124458 TTCTGTCCCCTGATTGTAGGCGG - Exonic
947014950 2:225609134-225609156 AGCTGTTCTCTGATTTTAGTAGG - Intronic
947676565 2:231986533-231986555 AGCTGTTCCCAGATTAAAGGAGG - Intronic
1168877883 20:1184032-1184054 TGCTGGTCCCTGTTTGTGGCTGG - Exonic
1169328510 20:4697542-4697564 TGCTGTTCCCTGGTCCTAGAAGG - Intronic
1170451539 20:16489071-16489093 TGCTGTTGCCAGTTTGTGGGTGG - Intronic
1172906927 20:38377330-38377352 TGCTTTTCCCTCATTGAAGCAGG + Intergenic
1173834062 20:46113617-46113639 TGCTGTTCCCTGATGGGTGGTGG + Intergenic
1175424052 20:58853320-58853342 GGCTGTTCCCCGATTTCAGGGGG - Exonic
1176256233 20:64154580-64154602 TGTTGTTCCCAACTTGTAGGTGG - Intronic
1176510702 21:7745440-7745462 TGTTGCTCCCTGAGTGTTGGGGG + Intronic
1178644815 21:34375969-34375991 TGTTGCTCCCTGAGTGTTGGGGG + Intronic
1178731685 21:35109148-35109170 TGCTCTTCCCTGATGGCATGTGG - Intronic
1179415202 21:41192863-41192885 TGCTCTTTCTTGGTTGTAGGAGG + Intronic
1180836922 22:18934551-18934573 TGCTGTTCCGTGACTGTGGGAGG - Intronic
1182933739 22:34200017-34200039 TGCTGGTCCCTGAGTGCTGGAGG + Intergenic
1183567855 22:38629225-38629247 TGCTGTTGGCTGAGTGTAGGAGG - Intronic
1203287015 22_KI270734v1_random:159850-159872 TGCTGTTCCGTGACTGTGGGAGG - Intergenic
951162433 3:19441073-19441095 TGCTGTTCCCTCAGTGGAGGCGG + Intronic
951883757 3:27504334-27504356 TCCTGTGCCCAGATTGTTGGTGG + Intergenic
952416354 3:33094300-33094322 TGCTGGTTCCTGGTTGCAGGCGG - Exonic
952696254 3:36268069-36268091 TGCCCTTCCCACATTGTAGGTGG - Intergenic
953843071 3:46405581-46405603 TGCTGATCCCAGGCTGTAGGGGG + Intergenic
955364550 3:58299875-58299897 TGCTGTTCCCTGGGTGATGGGGG + Intergenic
962843927 3:139259020-139259042 TGCTGTTCCCTGGTTCTAATTGG + Intronic
964546006 3:157834597-157834619 TCCTGGTGACTGATTGTAGGAGG - Intergenic
967605795 3:191444912-191444934 TGCTGTTCTCTGAGTGTTAGGGG - Intergenic
969577893 4:8047070-8047092 TGGTGTGCGCTGAGTGTAGGAGG - Intronic
969606440 4:8204504-8204526 CACTGTTCACTGATTGTGGGTGG - Intronic
970275878 4:14400144-14400166 TGCTATTCCATCATTGTTGGAGG - Intergenic
972243818 4:37223592-37223614 TGCAGTTCTCTGTTTTTAGGGGG - Intergenic
980074719 4:128283004-128283026 TGCTGCTCCCTTATTCCAGGTGG - Intronic
980993598 4:139759960-139759982 TGCTGTTAACTGATTATAGTAGG + Intronic
981122822 4:141072163-141072185 TGCTGTTGCATGGTTGTAGGTGG - Intronic
981633872 4:146852595-146852617 TGTTGTTCCCTCATTGGAGCAGG - Intronic
983599743 4:169513632-169513654 GCCTGTTCCCTAATTGTAGAGGG + Intronic
984861604 4:184245172-184245194 AGCTGTCCCCTGATTGCAAGAGG + Intergenic
986959790 5:13198870-13198892 GCCTCTTCCTTGATTGTAGGAGG - Intergenic
987757119 5:22110557-22110579 TGCTCTTCCTTGCTTCTAGGTGG + Intronic
990697761 5:58440761-58440783 TGGTCTTCCCTGATTCTAAGTGG - Intergenic
992541339 5:77767677-77767699 TTCTGTTCACTGATTGTCTGTGG - Intronic
994267223 5:97732317-97732339 TGCTGTTCTCTGATTATATCAGG - Intergenic
994919819 5:106029776-106029798 TGAGGTTCCCTGATGTTAGGGGG + Intergenic
995028278 5:107449392-107449414 TACTCTTCCCTGATGGTAAGTGG + Intronic
1000003941 5:157165873-157165895 TGCTGTTCACAGATTTTAGTTGG + Exonic
1001217474 5:169869214-169869236 TGTTCTTCCCTGAATGTAGATGG - Intronic
1003581129 6:7341883-7341905 TGCAGTACCCTGATTGGAGAGGG - Intronic
1004687193 6:17957701-17957723 TGGTGTTCACTGCTTGTTGGTGG + Intronic
1005090837 6:22055639-22055661 TGCTATCCTCTGGTTGTAGGAGG - Intergenic
1006739513 6:36297416-36297438 TTCTGTTCCCAGATGGCAGGTGG - Intronic
1007054197 6:38865744-38865766 TGCTGTACCCAGCTTGCAGGTGG + Intronic
1012074325 6:94665197-94665219 TGTTGTTCCCTCATTGTCAGAGG - Intergenic
1012496774 6:99842361-99842383 TTCTGTTTCCTGAATCTAGGTGG + Intergenic
1018733758 6:166672304-166672326 TTCTCTTCCCTGAATGTTGGCGG - Intronic
1019738344 7:2661192-2661214 TGCTGTGGCCTGGCTGTAGGTGG + Intronic
1021403382 7:20236287-20236309 TGCAGTTCCCTGAGCGTGGGAGG - Intergenic
1021737147 7:23650915-23650937 TGCATTTCCCTGATGGAAGGAGG - Intergenic
1022161435 7:27714950-27714972 TGCTGTTTGGTTATTGTAGGAGG + Intergenic
1022844871 7:34199945-34199967 TGCTCTTCCTTGTTTGAAGGTGG - Intergenic
1027687407 7:81294899-81294921 AGCTGTTCCTGGATTGAAGGAGG + Intergenic
1030630465 7:111889772-111889794 TGCTGTTTCCTGGTTGGAGAGGG - Intronic
1032751417 7:134845680-134845702 TGCTGCTTCCTGCCTGTAGGTGG - Intronic
1034680330 7:152923654-152923676 TTTTGTTGCCTGATTGTGGGAGG + Intergenic
1036755797 8:11470369-11470391 TGCTGGCCCCTGATTGTGGCAGG - Intronic
1037319293 8:17628838-17628860 TGCTGTTCCCTGCCTGCAGATGG + Intronic
1039369932 8:36974059-36974081 TGCTGTCCCCGGACTGTAGGAGG - Intergenic
1041394014 8:57373664-57373686 TGCTGTTTCCTGGTTCTTGGAGG + Intergenic
1045764890 8:105655734-105655756 TACTGTGTACTGATTGTAGGTGG - Intronic
1045821539 8:106344158-106344180 TGGGGTTCCCTGGTTTTAGGAGG + Intronic
1051636406 9:19184467-19184489 TTATGTTCCCTGATGTTAGGGGG - Intergenic
1051713922 9:19961842-19961864 TTCACTTCCCTGACTGTAGGTGG - Intergenic
1053167889 9:35857436-35857458 TGCTGTTCTCTGATAATAGCTGG - Intergenic
1058045689 9:100354324-100354346 TGCTGATACCAGACTGTAGGGGG - Intergenic
1060044778 9:120331296-120331318 TGCTCTTCCTTCATTGTTGGTGG + Intergenic
1060888878 9:127175793-127175815 TGATGTGCCCTGTTTGTAAGGGG + Intronic
1186368798 X:8925639-8925661 TGCTGTTCCTTCATTCTGGGGGG - Intergenic
1189921875 X:45910258-45910280 TGCTGTTCATTGACTGAAGGGGG - Intergenic
1190371655 X:49748417-49748439 TCCTGTTCCCTGAGTGGAGAGGG - Intergenic
1192985025 X:76388967-76388989 TGCAGTTCCCTGATCATTGGTGG + Intergenic
1202073516 Y:21016395-21016417 GGCTGTTCCTTGTTTGAAGGTGG + Intergenic
1202078216 Y:21058249-21058271 GGCTGTTCCTTGTTTGAAGGTGG + Intergenic