ID: 932286860

View in Genome Browser
Species Human (GRCh38)
Location 2:70541856-70541878
Sequence GACCTAGGGTGTTATAATTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 67}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932286860_932286866 24 Left 932286860 2:70541856-70541878 CCCTAATTATAACACCCTAGGTC 0: 1
1: 0
2: 0
3: 4
4: 67
Right 932286866 2:70541903-70541925 ATTGTTGAAATTTGCTGGCAGGG 0: 1
1: 0
2: 0
3: 23
4: 281
932286860_932286865 23 Left 932286860 2:70541856-70541878 CCCTAATTATAACACCCTAGGTC 0: 1
1: 0
2: 0
3: 4
4: 67
Right 932286865 2:70541902-70541924 CATTGTTGAAATTTGCTGGCAGG 0: 1
1: 0
2: 1
3: 19
4: 182
932286860_932286864 19 Left 932286860 2:70541856-70541878 CCCTAATTATAACACCCTAGGTC 0: 1
1: 0
2: 0
3: 4
4: 67
Right 932286864 2:70541898-70541920 CTGTCATTGTTGAAATTTGCTGG 0: 1
1: 0
2: 0
3: 16
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932286860 Original CRISPR GACCTAGGGTGTTATAATTA GGG (reversed) Intronic
902194339 1:14787162-14787184 GACCTTGGATGTATTAATTATGG + Intronic
911008312 1:93251743-93251765 GTCTTAGGGTGTTATTATTTGGG + Intronic
912769526 1:112450919-112450941 TACCTAGAGGCTTATAATTAGGG + Intronic
917389321 1:174516702-174516724 AAACAAGTGTGTTATAATTAGGG + Intronic
919540805 1:198843073-198843095 GACCTAAGATGTTGGAATTAGGG + Intergenic
923994532 1:239477983-239478005 CACCTAGGGTGTGATAATCCAGG + Intronic
1069482547 10:68796949-68796971 TAACTAAGGTGTTCTAATTAGGG + Intergenic
1070265351 10:74896883-74896905 GATCTAGGGTGAGATAATTTGGG - Intronic
1074605546 10:114960964-114960986 GTCCTGGGGTAATATAATTAAGG + Intronic
1080349436 11:31366586-31366608 GAATTAGGGTGTTATAAGTAAGG + Intronic
1085120609 11:73965163-73965185 GACCTAGGATGTTAGAATTCCGG + Intronic
1089584322 11:119500680-119500702 GACCTAGCAAGTTAAAATTAAGG + Intergenic
1090109731 11:123893917-123893939 GACCTATGGTGTTAGAAAAATGG + Intergenic
1092029002 12:5268338-5268360 AGGCTAGGGTGTTCTAATTAAGG + Intergenic
1093713289 12:22352309-22352331 GACCTAGGGTGTTTTATTATGGG + Intronic
1093816999 12:23561024-23561046 GAACTATGGTCTTATAATTTAGG - Intronic
1095787748 12:46128742-46128764 GACCTTTGGTGTTATAAGAATGG - Intergenic
1100828828 12:98499549-98499571 GACTTTGGCTTTTATAATTAGGG - Intronic
1110080721 13:71307227-71307249 GACCAAGGTTAATATAATTATGG - Intergenic
1113188373 13:107716035-107716057 AACTTAGGGTGTTAAACTTAGGG + Intronic
1125614910 15:41002139-41002161 GACAGAGGGTGTTAAAATGATGG + Intronic
1126930716 15:53647417-53647439 CTCCTTAGGTGTTATAATTATGG - Intronic
1127873190 15:63090312-63090334 GCCCCAGGGTCTTTTAATTATGG - Intergenic
1138944121 16:61827170-61827192 GACCTAGAATGTTTTCATTATGG + Intronic
1139733018 16:68963422-68963444 GAACTAGGGTGTAAAAAGTAGGG - Intronic
1146548150 17:33756865-33756887 GACGTAGGGTCTTATAGTTCTGG + Intronic
1151004994 17:70424590-70424612 GACCTAGTGCTTGATAATTAGGG - Intergenic
1155072915 18:22331859-22331881 ACCCTAGGGTGTTATATTTTTGG + Intergenic
1156868110 18:41911717-41911739 AACCTAGGGTGATATTGTTATGG + Intergenic
926976588 2:18522073-18522095 GAGATGGGGTGTTAAAATTAGGG - Intergenic
928625336 2:33134058-33134080 GCCCAAGGGTGTTATTTTTAGGG + Intronic
932286860 2:70541856-70541878 GACCTAGGGTGTTATAATTAGGG - Intronic
942835326 2:180288982-180289004 GACCTGGGTTGTTATAATCTGGG - Intergenic
943662775 2:190576928-190576950 GAACAAGGCAGTTATAATTAGGG - Intergenic
944314233 2:198268272-198268294 GACCTAGAGAGATATAAGTATGG - Intronic
945054599 2:205857479-205857501 GACCAAGGGTGTTACAATGGTGG - Intergenic
946769841 2:223077457-223077479 GACCTAGATTGTTTTAAATAGGG - Intronic
947738647 2:232474427-232474449 GAGTTAGGGTGCTATATTTAAGG + Intergenic
1176732640 21:10515857-10515879 GTGCTACGGTGTTATAACTACGG + Intergenic
1177684964 21:24424012-24424034 TACCGATGGTGTTATATTTATGG + Intergenic
1181689049 22:24548191-24548213 GACCTAGGGTCTCATGATGAAGG - Intronic
949319420 3:2792107-2792129 GACCTAGGCAGATATAAATAAGG - Intronic
950094781 3:10322425-10322447 GGAGTAGGGTGTTAGAATTAAGG + Intergenic
951772384 3:26272979-26273001 CATCTATGGTGTTATAAGTAAGG + Intergenic
956598050 3:70990106-70990128 GAACTAGGGTGGTACAATTGAGG - Intronic
958527260 3:95279643-95279665 GAACTAGTCTGTTCTAATTATGG - Intergenic
960369450 3:116815863-116815885 GACCTTGGGTGTTATAGTCAGGG - Intronic
966056638 3:175701018-175701040 GACCTAGGTTGTTGTCATTTGGG - Intronic
970418365 4:15881558-15881580 GAACTATGGTGCTATAATAAAGG - Intergenic
976761401 4:88553130-88553152 GACCATGGGTAATATAATTATGG + Intronic
977933669 4:102776480-102776502 TACCTAAGGTGGTATTATTAGGG - Intergenic
984687103 4:182681825-182681847 GACCCTGGGTGTTCTAATCATGG + Exonic
986102254 5:4624453-4624475 AAATTAGGGTGTTATAATTTTGG + Intergenic
994369532 5:98952329-98952351 GACCTAGGGTGTTTTTAACATGG + Intergenic
999212842 5:149905254-149905276 GACCTAGGGTGCAATAATGGAGG - Intronic
1003261185 6:4517524-4517546 GGCCTAGTGTGATTTAATTACGG - Intergenic
1004015119 6:11725168-11725190 GCCCTAGGGTGTAAAACTTAAGG + Intronic
1004628060 6:17394599-17394621 GACCTTTGGTTTTATAGTTATGG + Intronic
1004840469 6:19577850-19577872 TAACTATGGTGTTATAACTATGG - Intergenic
1021197527 7:17689676-17689698 GGCCAAGTGTGTTGTAATTAAGG - Intergenic
1022543656 7:31164417-31164439 GACCTATGGTGAAATATTTAAGG - Intergenic
1023733943 7:43218619-43218641 TACCTAGGGTGTTTTACTCATGG + Intronic
1034596943 7:152205669-152205691 GTGCTACGGTGTTATAACTACGG - Intronic
1043724104 8:83587618-83587640 TACCTATGTTGTTATAATTGGGG + Intergenic
1047979556 8:130166409-130166431 GACCTTGGGTGTTGTACTAAGGG - Intronic
1048825968 8:138427103-138427125 AACCTATGGTGTTATAACTCAGG + Intronic
1052005552 9:23343746-23343768 GATCTAGGGTTTTATAATCAGGG + Intergenic
1061569802 9:131470207-131470229 GACCTACGGTGTTACAGTGAGGG - Intronic
1186010843 X:5131151-5131173 AATCTTGGGTGTTATATTTATGG + Intergenic
1189780818 X:44512634-44512656 GATCTAGGCAGTGATAATTAAGG + Intergenic
1195205059 X:102590389-102590411 GACCTAGGGTTTGATCAGTAGGG + Intergenic
1198501815 X:137257089-137257111 TACCTAGTGTGTTAAATTTAGGG - Intergenic