ID: 932294786

View in Genome Browser
Species Human (GRCh38)
Location 2:70615339-70615361
Sequence TTGTGTAAGAGGAAGGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 181}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932294780_932294786 19 Left 932294780 2:70615297-70615319 CCACCATGTAACAGCACAATATT 0: 1
1: 0
2: 0
3: 12
4: 132
Right 932294786 2:70615339-70615361 TTGTGTAAGAGGAAGGTGTCTGG 0: 1
1: 0
2: 2
3: 21
4: 181
932294782_932294786 -5 Left 932294782 2:70615321-70615343 CCAAAACTTGCTCTTCCTTTGTG 0: 1
1: 0
2: 0
3: 34
4: 339
Right 932294786 2:70615339-70615361 TTGTGTAAGAGGAAGGTGTCTGG 0: 1
1: 0
2: 2
3: 21
4: 181
932294781_932294786 16 Left 932294781 2:70615300-70615322 CCATGTAACAGCACAATATTGCC 0: 1
1: 0
2: 3
3: 17
4: 106
Right 932294786 2:70615339-70615361 TTGTGTAAGAGGAAGGTGTCTGG 0: 1
1: 0
2: 2
3: 21
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932294786 Original CRISPR TTGTGTAAGAGGAAGGTGTC TGG Intronic
900596888 1:3484022-3484044 TGGCGTGAGAGGAAGGTGTGCGG - Intergenic
901653736 1:10757406-10757428 TGGTGTGAGAGGATGGTGGCTGG - Intronic
902872897 1:19324982-19325004 ATGTCTAACAGGAAGGTTTCGGG + Intronic
905163278 1:36056493-36056515 TTGTGTATGAGATAGGAGTCAGG - Exonic
906680445 1:47722611-47722633 CTGTGGAAGAGGAAGATTTCAGG + Intergenic
907413533 1:54298710-54298732 TTGTGGAGGTGGAAGGGGTCAGG - Intronic
907851339 1:58258042-58258064 ATGTGTACGAGGAATGTGTTGGG - Intronic
908216604 1:61960326-61960348 TTGTGTAATAGGAAGATATGAGG - Intronic
908374800 1:63524377-63524399 TGGTGTAATATGAAAGTGTCAGG + Intronic
908931143 1:69316752-69316774 TTGTGGAGGAGGCAGGTGTCCGG + Intergenic
910729385 1:90376144-90376166 CTGTGTGAAAGGAAGTTGTCTGG + Intergenic
911432813 1:97813983-97814005 TTCTGCAAGAGGAATGAGTCTGG + Intronic
912707505 1:111925891-111925913 CTGGGAAAGAGGATGGTGTCGGG - Intronic
912880661 1:113409775-113409797 TTGTGTAATAGGTGGGTGTCAGG + Intronic
913281320 1:117187590-117187612 TTGTGTTAGAGCAATGTATCTGG - Intronic
913456559 1:119037787-119037809 GTGTATGAGAGGGAGGTGTCAGG - Intronic
916164594 1:161954549-161954571 TTGTTTATGATCAAGGTGTCTGG + Intronic
916600717 1:166290719-166290741 ATGTGAAAGGGGAAGGGGTCTGG + Intergenic
917719979 1:177778085-177778107 CTGTGGAAGAGGAATGTGTATGG - Intergenic
919700776 1:200628980-200629002 GTGGGGAAGAGGAAGGTGACTGG + Intronic
919981352 1:202644310-202644332 TTGTGGAGGTGGGAGGTGTCGGG - Intronic
920664957 1:207956525-207956547 AGGTGTCAGAGGGAGGTGTCAGG - Intergenic
920668823 1:207987330-207987352 GGGTGGAAGAGGAGGGTGTCAGG - Intergenic
921196031 1:212759292-212759314 TTGTGGAGGAGGCAGGTGCCAGG - Intronic
923435429 1:233963642-233963664 TTCCGTAAGAGGCAGGTGCCAGG + Intronic
924619403 1:245647654-245647676 TTGTGTAGGAGGAAAAAGTCGGG + Intronic
1063170809 10:3508448-3508470 TTATGTAAGAGGGAGGTGGGAGG + Intergenic
1065207232 10:23368665-23368687 TTGTCTAAGAGGAAGGTTTTGGG + Intergenic
1068084249 10:52355125-52355147 TTGAGGAGGAAGAAGGTGTCAGG + Intergenic
1070830120 10:79413078-79413100 TTGTGTTTGTTGAAGGTGTCTGG - Intronic
1075079885 10:119376232-119376254 ATTTGGAAGAGGAAGGTGACTGG - Intronic
1075677746 10:124307998-124308020 CTGTGTCTGGGGAAGGTGTCAGG + Intergenic
1080518200 11:33042609-33042631 ATGTTTAAGAGGAATGTGTGGGG - Intronic
1080862465 11:36161642-36161664 TTCTGTAAGAGGAATTTGCCGGG - Intronic
1085723742 11:78935601-78935623 TTGGGTAACAGGAAGCTGTCTGG + Intronic
1085988864 11:81815643-81815665 TTTGGAAAGAGGAAGGTGTTTGG + Intergenic
1088840914 11:113627079-113627101 GTGTGTGAGAGGATGGTTTCAGG - Intergenic
1089620032 11:119716910-119716932 GTGTGTATGAGGAAGGTTTATGG - Intronic
1089861902 11:121597275-121597297 TTGGTTAAGAGGAAGGAGTGTGG + Intronic
1090250599 11:125248176-125248198 TTGTCTCAGAGGGAGGTGTCTGG + Intronic
1091748722 12:3009771-3009793 CTGTGTCAGAGGAAGGAGTGGGG - Intronic
1096392337 12:51239063-51239085 TTGGGTATGACGAAGGCGTCAGG - Intronic
1096483794 12:51962178-51962200 TTGCATAAGAGAAAGGTGTTTGG - Intronic
1096541880 12:52312603-52312625 TTGTGTATGATGAAGGTCTCTGG + Intergenic
1100143837 12:91653085-91653107 TTTTGTAAGAGCAAGGTGGAAGG - Intergenic
1106620052 13:31364326-31364348 CTGTGTGAGAGGAGGGGGTCAGG - Intergenic
1107660270 13:42631965-42631987 TTAAGTATGAGGAAGGTGCCAGG + Intergenic
1108626049 13:52229780-52229802 CTGAGTTAGAGGAAGGTGTGTGG + Intergenic
1108660014 13:52576699-52576721 CTGAGTTAGAGGAAGGTGTGTGG - Intergenic
1109185298 13:59260787-59260809 TTTTGTATCAGGAAGGTGACAGG - Intergenic
1109219880 13:59630335-59630357 TTGTGTAAGTGGATGTTTTCAGG + Intergenic
1109225171 13:59685018-59685040 TGCTGTAAGAGAAAGCTGTCAGG - Intronic
1111982733 13:95033959-95033981 TTCTATAAGAGGCAGTTGTCAGG - Intronic
1118444386 14:65838300-65838322 TGGTGTCAGAGGAAAGTTTCTGG + Intergenic
1118477806 14:66134719-66134741 TTGAGAAAGAAGAAGGAGTCAGG - Intergenic
1121001739 14:90455973-90455995 TTGTGGAAGAGGCAGCTGGCTGG + Intergenic
1121843481 14:97154021-97154043 TTGTGTAAGAAGAAGTTAACAGG + Intergenic
1123037578 14:105477766-105477788 GTGTGTGAGAGGAAGGTGTGTGG + Intronic
1123771689 15:23535813-23535835 TTGTATAAGAGTAACATGTCTGG + Intergenic
1127585187 15:60371607-60371629 TTGTGTTTGATGAAGGTCTCGGG + Intronic
1128543830 15:68554482-68554504 TTCTGCAAAAGGAAGGTGCCTGG - Intergenic
1128741104 15:70084210-70084232 TTGTTATAGAGGAAGGAGTCTGG - Intronic
1129118729 15:73381830-73381852 TTGGGGCAGAGGAAGGAGTCAGG - Intergenic
1130905165 15:88235051-88235073 TTGTGTAAGGGTAGGGCGTCTGG - Intronic
1132080544 15:98861266-98861288 TTATCTGAGAGGAAGGTGTAAGG - Intronic
1133153507 16:3854977-3854999 TTATGTAAGAGGATGTTGTTAGG - Intronic
1134596575 16:15500527-15500549 TTGAGGAAGGGGAAGGTATCAGG + Intronic
1139594239 16:67948823-67948845 TTGGGTGAGAGGAAGGGGTGTGG + Intronic
1141791673 16:86241092-86241114 TTGTGGAAGAGGCAGCTGTATGG - Intergenic
1142285447 16:89169772-89169794 TTGTGTCAGAGGTAGGTGGCAGG - Intergenic
1142874607 17:2843976-2843998 TTGGGTAAAAGGAAGATGGCCGG + Intronic
1146508920 17:33429080-33429102 GTGTGTCAGGGTAAGGTGTCTGG + Intronic
1146538803 17:33676855-33676877 TGGTGGAGGTGGAAGGTGTCTGG + Intronic
1146712320 17:35053118-35053140 TAGTGGAAGAGGAAGGGGACAGG + Intronic
1147943079 17:44064094-44064116 TTGGGCAGGAGGAAGGTGACAGG - Intronic
1149775064 17:59350885-59350907 TTGTGTAAGACGGATGGGTCTGG + Intronic
1150944339 17:69728555-69728577 AGGTGTTAGAGGAAGGTATCTGG - Intergenic
1152720220 17:81919958-81919980 GTGTGGAAGAGGAGGGTGTAAGG - Exonic
1156147739 18:34206147-34206169 ATCTGTAAGAGAAAGTTGTCTGG - Intronic
1159871012 18:73759692-73759714 TTGTGTGAAAGGAAGGAGGCTGG + Intergenic
1160264156 18:77324426-77324448 TTGTGTAAGAGGAAGAACTTGGG + Intergenic
1160382535 18:78471563-78471585 TAGTGTGAGATGAAGATGTCAGG - Intergenic
1160395239 18:78566039-78566061 TTTTCTAAGAGGAAGGCGTAGGG + Intergenic
1165781653 19:38438124-38438146 TGGGGTAAGAGGAGGGAGTCTGG - Intronic
1166826723 19:45614451-45614473 TTGTGTAAGAGGAAAGGGTAGGG - Intronic
1166992950 19:46704246-46704268 CTGTGGATGAGGAAGGTGTGCGG + Exonic
931065041 2:58576450-58576472 TTTTGTAAGAGGAATATGTGTGG + Intergenic
932294786 2:70615339-70615361 TTGTGTAAGAGGAAGGTGTCTGG + Intronic
932895716 2:75637667-75637689 GTGTGAGAGAGGAAGGGGTCAGG - Intergenic
936343075 2:111654840-111654862 CAGTGTGGGAGGAAGGTGTCAGG - Intergenic
936358524 2:111773767-111773789 TTGAGTAAGTGGAAGGGGCCAGG + Intronic
937519216 2:122691192-122691214 TTGTGGAAGAGTAAGGAGGCCGG + Intergenic
938130462 2:128710998-128711020 TTGAGAAAGAGGAAGGGGGCAGG + Intergenic
938964137 2:136373177-136373199 TTGTGAAAGATGAATGTTTCAGG + Intergenic
941185189 2:162313965-162313987 CTGTGTAAATGGAAGGTGTGTGG + Intronic
941662745 2:168212157-168212179 TTCTGTAAAAGGAAGGTAACAGG - Intronic
942983927 2:182116465-182116487 GTGTGTAGGATGAAGATGTCTGG + Intronic
943295311 2:186130749-186130771 ATGTGTAATATGAAGTTGTCAGG - Intergenic
945015907 2:205515972-205515994 TTGTATATAAGGAAGGGGTCTGG + Intronic
946037364 2:216754785-216754807 ATGTGTAGGAGGGAGGTGGCAGG + Intergenic
1170244418 20:14204808-14204830 TTGTGTAGGAGGCAAGTGCCTGG + Intronic
1173185053 20:40834204-40834226 TTGAGTAAGAGGGAGGTGGACGG + Intergenic
1175415250 20:58796725-58796747 GTGTGGAAGGGGCAGGTGTCTGG - Intergenic
1175658586 20:60793036-60793058 TTGTTTGAGAGGCAGGTGTCAGG - Intergenic
1176676159 21:9779430-9779452 CTGTGTTAGAGGAATGTCTCAGG + Intergenic
1177452178 21:21284266-21284288 TAGTGCAAAAGGAAGGTGTTAGG + Exonic
1178361279 21:31950274-31950296 TATGGGAAGAGGAAGGTGTCAGG + Intronic
1179477062 21:41653744-41653766 TTGAGGAAGAGGAAGATGTCAGG - Intergenic
1179945327 21:44670333-44670355 TTGTGGAAGAGGCAAGTGTCAGG - Intronic
1180153136 21:45962690-45962712 TTGTGCAAGAGGGAGGAGCCTGG - Intergenic
1182517204 22:30865679-30865701 TTGCGTCAGTGGAAGGTGACCGG + Intronic
949198024 3:1336826-1336848 GTGTCCAAGAGGAAGGTGTCTGG - Intronic
950756025 3:15173392-15173414 CAGTGTAAGAGGAAGGTCTGGGG - Intergenic
953755958 3:45646135-45646157 TTGTGTAAGATGAGTGTGGCTGG - Intronic
954998824 3:54907290-54907312 ATGTGTAAGAGGAGGTTGTTTGG + Intronic
955900087 3:63744004-63744026 TTTAGTGAGAGGAAGGAGTCAGG - Intergenic
958465547 3:94453393-94453415 TTGTGGAAGGGGATGGTTTCAGG + Intergenic
958853662 3:99358583-99358605 TTGTGGAAAAGGAAGGAATCGGG + Intergenic
958872550 3:99578310-99578332 TTATGTGCCAGGAAGGTGTCAGG + Intergenic
961256532 3:125559359-125559381 TTGTGCAGCAGGAAGTTGTCTGG - Intronic
963496853 3:146075147-146075169 CTGTGAAAGAGGAAGGTATGTGG + Intronic
963608924 3:147440774-147440796 TTGTGGAAGGGGAAGGTTTTGGG + Intronic
964916358 3:161846739-161846761 ATGAGTATGAAGAAGGTGTCAGG + Intergenic
967972988 3:195012846-195012868 TTGTGTTAAAGGCAAGTGTCTGG - Intergenic
968075825 3:195815767-195815789 CTGTGTAAGAAGAAGGAGGCCGG - Intergenic
969612510 4:8235334-8235356 GTGTGTGAGAGGAAGGAGGCTGG + Intronic
970665252 4:18329367-18329389 TTGTATTAGAGGAAGATGGCTGG + Intergenic
970807537 4:20053890-20053912 TTGCTTAAGAGGCAGGTGGCCGG - Intergenic
973813386 4:54595158-54595180 TTGATTAAGAGGCAGGGGTCAGG + Intergenic
976111764 4:81682920-81682942 TTGTGTAAGTGTAAACTGTCTGG - Intronic
977055607 4:92186848-92186870 CTGTGAAAGAAGAAGGTTTCAGG + Intergenic
977371171 4:96138596-96138618 TTGTGGAAGAGCAAGTTGACAGG + Intergenic
977397884 4:96494190-96494212 TTGTGGAGGAGGAAAATGTCAGG - Intergenic
980171886 4:129299176-129299198 TTATGTAAGAAGAAGGTTTATGG + Intergenic
981258954 4:142696514-142696536 TTGTGTAGGAGACAGATGTCAGG - Intronic
983167212 4:164492614-164492636 TTGTGTCAGAGGATGGTTTCAGG - Intergenic
983400008 4:167250776-167250798 CTGAGAAAGAGGATGGTGTCAGG - Intergenic
985399369 4:189579316-189579338 CTGTGTTAGAGGAATGTCTCAGG - Intergenic
989098791 5:37805820-37805842 TGGTGTAAAAGGAAGATTTCGGG + Intergenic
989662740 5:43816649-43816671 CAGTGTTAGAGGAAGGGGTCTGG + Intergenic
989768344 5:45112840-45112862 TTTTTTAGGAAGAAGGTGTCAGG - Intergenic
990489902 5:56294479-56294501 TTGTGGAAGAGAAAGGAGTTGGG + Intergenic
990637755 5:57748529-57748551 TTGAGATAGAGGAAGGTGTGGGG + Intergenic
990639758 5:57769468-57769490 TTGTCTAATAGGACGGTTTCAGG + Intergenic
993050973 5:82925500-82925522 GTGTGTTAGGGGAAGTTGTCAGG + Intergenic
995755418 5:115498243-115498265 TTTTGTAAGTGGAATGTTTCTGG - Intergenic
996825078 5:127673766-127673788 ATGAGTAAGAGGAAGGTGACTGG + Intergenic
998884072 5:146675957-146675979 TTGTGTAATAGGGAGCTGTCAGG + Intronic
1002946583 6:1766971-1766993 TGGTGTGAGAGGAAGGTTTGGGG - Intronic
1004214394 6:13687917-13687939 TTTTGTGGGAGGAATGTGTCTGG - Intronic
1005560834 6:27039278-27039300 TTGTGGAAGAGGAAGGTGCCAGG - Intergenic
1005563855 6:27069287-27069309 TTGTGGAAGAGGAAGATTCCAGG - Intergenic
1007066101 6:38991708-38991730 CTGAGTAACAGGAAGCTGTCTGG - Intronic
1008871944 6:56282665-56282687 TTGTGTAAGACAAAGGTGTCTGG - Intronic
1009318912 6:62260288-62260310 TTTTGTAAAAGGAAGGTACCTGG - Intronic
1009677789 6:66848661-66848683 TTATGTAAGAAAAAGATGTCTGG - Intergenic
1012974681 6:105767790-105767812 CTGTGAAAGAGGAAGGTGGTTGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1014015937 6:116529876-116529898 GTGTGTAAGAGGAGTGTGTGCGG + Intronic
1014087385 6:117363153-117363175 TTGTGTAGATGGAAGCTGTCTGG + Intronic
1014658785 6:124140182-124140204 TTATGCAAAAGGAAGGTCTCAGG - Intronic
1015164832 6:130192295-130192317 TTTTTTAAGAGACAGGTGTCAGG + Intronic
1015373669 6:132485296-132485318 TTTTGAAAAAGGATGGTGTCTGG + Intronic
1015458703 6:133462736-133462758 TTTGGTAAGAATAAGGTGTCTGG - Exonic
1016367379 6:143334254-143334276 TTGTGTCAGAGGAAAGAGCCAGG - Intronic
1017964501 6:159252243-159252265 CTGTGTAAGAGGAAGAAGTATGG + Intronic
1018247693 6:161838600-161838622 ATGAGGAAGAGGAAGGTGGCTGG - Intronic
1019070313 6:169340344-169340366 TTGGGTGAGAGGAAAGTGCCTGG + Intergenic
1019965962 7:4498866-4498888 GTGTGTAAGAGGAGGGAGTCAGG - Intergenic
1021438203 7:20646146-20646168 TTGTTTGAGAACAAGGTGTCAGG + Intronic
1024223503 7:47305690-47305712 TTCTGTCAGAGGAATGTGCCTGG - Intronic
1028361236 7:89969362-89969384 TTGTATAAGAGAAAGTTGCCAGG - Intergenic
1028682523 7:93553039-93553061 TTTTGAAAGAAGAAGGTGTGAGG - Intronic
1030149451 7:106388273-106388295 TTCTCTTAGAGGAAGGTGGCTGG + Intergenic
1032322287 7:130896435-130896457 TTGTGTAATAGCACAGTGTCTGG - Intergenic
1033638680 7:143238636-143238658 TTGTGGAAGAGGCAAGTGCCAGG + Intergenic
1035156926 7:156921665-156921687 ATGAGGAAGAGGAAGGTCTCTGG - Intergenic
1036752152 8:11450107-11450129 GTGTGAAAGAGCATGGTGTCCGG - Intronic
1038559834 8:28564399-28564421 TTGTATGAGAGGAAGGTGTTAGG - Exonic
1039260747 8:35768646-35768668 TTATGTAAGAGGAATGTGATAGG + Intronic
1040917682 8:52580196-52580218 TTGTGGGAGAGCAGGGTGTCGGG - Intergenic
1046747754 8:117894389-117894411 TTGTGTATGAGGCTGGTGTTTGG + Intronic
1046784804 8:118254567-118254589 TTGTGTGGGAGGAAGGAGTGAGG - Intronic
1046807384 8:118494608-118494630 GTGAATAAGAGGAAGGTGTTTGG - Intronic
1047129014 8:121997267-121997289 AAGTGTCAGAGGAAGGTGTCAGG - Intergenic
1049511428 8:143028649-143028671 GGGTGAAAGAGGAGGGTGTCTGG + Intergenic
1049677498 8:143898131-143898153 TGGTATATGAGAAAGGTGTCCGG + Intergenic
1050277155 9:4011744-4011766 AAGTGTCAGAGTAAGGTGTCTGG - Intronic
1051912380 9:22168855-22168877 TTGTTTAAAAGGAAGGTCTCTGG + Intergenic
1052877349 9:33576771-33576793 TTGTGTATGTGGATGATGTCCGG - Intergenic
1053025093 9:34722997-34723019 TTGTGTTAAGGGAAGGTGTGAGG - Intergenic
1053036617 9:34832059-34832081 TTGTGTTAAGGGAAGGTGTGAGG - Intergenic
1057258528 9:93569840-93569862 GGGGGTAGGAGGAAGGTGTCAGG + Intergenic
1057678108 9:97152115-97152137 TTGTGTATGTGGATGATGTCCGG + Intergenic
1059386813 9:113971126-113971148 TTGTGTAAGAACAATGTGTGAGG + Intronic
1186657780 X:11633626-11633648 ATGTGGAAGTGGAAGGCGTCTGG + Intronic
1188355656 X:29187703-29187725 TTGTGTAAATGAAAGGTGTTAGG - Intronic
1189220730 X:39369442-39369464 CTGTGCAAGAGGGAGGTGCCAGG - Intergenic
1193553755 X:82929783-82929805 TCGTCTTAGAGGAAGGTGGCTGG - Intergenic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic
1197807469 X:130411613-130411635 GTGTGAAAGGGGAAGGTGTGGGG + Intronic
1198734857 X:139774159-139774181 TTGTGGAACATAAAGGTGTCAGG - Intronic
1200268590 X:154660309-154660331 TTGTCTGTGAGGAAGGTGTTGGG + Intergenic
1200334212 X:155331753-155331775 GTGTTTAAGAGTATGGTGTCTGG - Intronic
1200963859 Y:9018945-9018967 GGGTGTCAGAGGAAGGTGGCTGG + Intergenic