ID: 932300570

View in Genome Browser
Species Human (GRCh38)
Location 2:70664070-70664092
Sequence CAGAGAAAGGAGAAGGCGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 731
Summary {0: 1, 1: 0, 2: 5, 3: 63, 4: 662}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932300564_932300570 30 Left 932300564 2:70664017-70664039 CCCGGCTGGGGTCCAGCTCAGAG 0: 1
1: 0
2: 13
3: 50
4: 595
Right 932300570 2:70664070-70664092 CAGAGAAAGGAGAAGGCGTGAGG 0: 1
1: 0
2: 5
3: 63
4: 662
932300567_932300570 18 Left 932300567 2:70664029-70664051 CCAGCTCAGAGTTTTTCTAGGCA 0: 1
1: 0
2: 1
3: 14
4: 156
Right 932300570 2:70664070-70664092 CAGAGAAAGGAGAAGGCGTGAGG 0: 1
1: 0
2: 5
3: 63
4: 662
932300565_932300570 29 Left 932300565 2:70664018-70664040 CCGGCTGGGGTCCAGCTCAGAGT 0: 1
1: 0
2: 1
3: 19
4: 202
Right 932300570 2:70664070-70664092 CAGAGAAAGGAGAAGGCGTGAGG 0: 1
1: 0
2: 5
3: 63
4: 662

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932300570 Original CRISPR CAGAGAAAGGAGAAGGCGTG AGG Intronic
900932879 1:5747793-5747815 GAGAGAAAGGAGAAAGAGGGAGG + Intergenic
901218730 1:7570190-7570212 CACAGGAAGGAGGTGGCGTGAGG - Intronic
901842249 1:11961006-11961028 CAGAGAAAGAGGAAGGACTGGGG + Intronic
903179730 1:21599109-21599131 CAAAGAAAGGAGGAGGCGGCAGG + Intronic
904079380 1:27862539-27862561 CAGAGAGAGGAGGAGAGGTGGGG - Intergenic
905087075 1:35390364-35390386 CAGTGAAGGGAGATGGGGTGGGG + Intronic
905403811 1:37720258-37720280 CAGGGAAAGGAGTAGAAGTGGGG + Intronic
905491386 1:38346727-38346749 GAGAGAGAGGAGAAGGGGAGGGG + Intergenic
906080586 1:43085798-43085820 CAGTGAAGGGAGATGGGGTGGGG - Intergenic
906156562 1:43617419-43617441 CAGAGAATGGAGAAAGCGGGTGG - Intronic
907443086 1:54490386-54490408 AAGAGGATGGAGAAGGCGTCTGG + Intergenic
907902128 1:58750637-58750659 CTGAGAAAGCAGAAGGGGAGGGG - Intergenic
907981259 1:59483801-59483823 CAGTGAAATGAGAAGTCCTGGGG + Intronic
908424622 1:63994553-63994575 CAGACAATGGAGAAGGCTTGTGG + Intronic
910051449 1:82978819-82978841 CAAAAACAGGAGAAGGGGTGAGG - Intergenic
911010816 1:93279164-93279186 CAGAGAAAGGAAAAGAGGCGAGG + Intergenic
911071726 1:93836964-93836986 CAGCGAAGGGAGATGGGGTGGGG - Intronic
911313388 1:96325725-96325747 CAGAAAAAGGAGAATGGATGGGG - Intergenic
911368657 1:96970986-96971008 CAGAGAGAGGAGAATGGGAGAGG - Intergenic
911788497 1:101980974-101980996 CAGAGAAATGAGCAGACATGAGG - Intronic
911968271 1:104395428-104395450 AAGAGAGGGGAGAAGGCGAGAGG + Intergenic
911991741 1:104706897-104706919 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
912417563 1:109520409-109520431 CAGAGAAGGGAGCAAGCTTGTGG + Intergenic
912902049 1:113661724-113661746 CAGAGAAAAGAGAAGGGTGGAGG + Intronic
914017672 1:143835515-143835537 GAGAGAAGGGAGAAGGCAAGGGG - Intergenic
914656282 1:149744050-149744072 GAGAGAAGGGAGAAGGCAAGGGG - Intergenic
914863632 1:151407114-151407136 CAGAAAAAGGAGAAAGTGGGAGG - Intronic
916620380 1:166490237-166490259 CAGAAAAAGGAAAAGACGAGGGG - Intergenic
916954099 1:169813674-169813696 CAGAAAAAGGAGAAGGTTAGCGG + Intronic
917159323 1:172040027-172040049 CAGAGAAAACAGAGGGCCTGTGG + Intronic
917256836 1:173124732-173124754 CAGTGAAGGGAGATGGGGTGGGG - Intergenic
917571074 1:176266046-176266068 CACAGCAAGGAGAGGGCCTGAGG - Intergenic
917966827 1:180184071-180184093 CAGAGGAAGGAGAAGAAGTGAGG - Intronic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
919074168 1:192793982-192794004 CAGTGAAGGGAGATGGGGTGGGG + Intergenic
919928850 1:202208386-202208408 GAGAGAGAGGAGAAGGAGGGGGG + Intronic
920101995 1:203522483-203522505 CGGTGAAAGGAGTGGGCGTGGGG - Intergenic
923142698 1:231174593-231174615 CAGAGAAGGGAGAGGGAGAGGGG - Intronic
923845959 1:237732857-237732879 CAGAGAATGGGAAAGGCCTGGGG - Intronic
924350260 1:243107805-243107827 GAGAGAAATGAAAAGGCGTTTGG - Intergenic
924539886 1:244970717-244970739 AGGAGAAAGAAGAAGGCGGGAGG - Exonic
924657337 1:245984899-245984921 CAGAGCAAGGAGAAGTCGGATGG - Intronic
924738579 1:246781041-246781063 CAGAGATAGGATAATGCCTGCGG + Intergenic
1063287968 10:4711310-4711332 AAAAGCAAGGAGCAGGCGTGTGG + Intergenic
1063362778 10:5471054-5471076 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
1063363666 10:5476889-5476911 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
1063365350 10:5487103-5487125 CAGAGAAAGGAAGGGACGTGGGG - Intergenic
1063430954 10:5987871-5987893 CAGAGTGGGGAGAAGGCGGGTGG + Intergenic
1063453760 10:6168949-6168971 AAGAGAAAGCATAAGGAGTGGGG - Intronic
1063542231 10:6945392-6945414 AAGAGAGAGGAGAAGGAGGGTGG - Intergenic
1063925075 10:10969594-10969616 CAGAGAATGGGGAAGGGGAGAGG - Intergenic
1064324317 10:14334405-14334427 CACAGAAGGAAGAAGGTGTGGGG + Intronic
1064333999 10:14422136-14422158 CAGAGGGAGGAGCAGGCTTGCGG - Intronic
1064697018 10:17976895-17976917 CAGAGAAAGGAGAAAGAGAAAGG - Intronic
1064927274 10:20582691-20582713 CAGAGAAAGTAGGAGGAGGGGGG - Intergenic
1064928995 10:20602870-20602892 CTGAGGAAGGAGTATGCGTGGGG + Intergenic
1065414125 10:25466076-25466098 CAGAAAAAGGAAAAGGGGAGGGG + Intronic
1065522906 10:26589173-26589195 CAGGGAAAGAAGAAGGGGTGAGG - Intergenic
1065527561 10:26638329-26638351 CAGGGAAAGAGGAAGGGGTGGGG - Intergenic
1065527926 10:26641192-26641214 CAGGGAAAAAAGAAGGGGTGGGG - Intergenic
1065528830 10:26648444-26648466 CAGGGAAAGAAGAAGGGGTGAGG - Intergenic
1065559275 10:26946059-26946081 CAGGGAAAGAAGAAGGGGTGGGG + Intergenic
1066022133 10:31314387-31314409 CAGAGAAAGGAAAAAGAGAGAGG - Intergenic
1066444718 10:35471237-35471259 CAGAGAAAGGGGGATGCGAGGGG + Intronic
1067184303 10:44014091-44014113 GAGGGAAAGGAGAAGGGGAGGGG - Intergenic
1067304259 10:45045564-45045586 CAGTGAAGGGAGATGGGGTGGGG + Intergenic
1067530013 10:47063607-47063629 CAGAGAAAGTATATGGAGTGGGG - Intergenic
1067672203 10:48333666-48333688 CAGGGAAAGAAGAAGGGGTGGGG + Intronic
1067725431 10:48767325-48767347 AAGGGAAGGGAGCAGGCGTGGGG - Intronic
1068131971 10:52906356-52906378 CAGGGAAAGGAGAATGCTAGAGG + Intergenic
1069548156 10:69343488-69343510 CAGAGAGAGAAGGAGGCTTGAGG + Intronic
1069879126 10:71580851-71580873 CAGAGAAAGGGGTAGGAATGGGG - Intronic
1069889736 10:71645453-71645475 CAGAGGAAGGAGGAGGAGAGAGG - Intronic
1069918358 10:71800882-71800904 GACAGAAAGGAGAAGGCAAGAGG + Intronic
1070205145 10:74251278-74251300 AAGAGAAAGGAGGAGGAGTAGGG + Intronic
1070835865 10:79446480-79446502 CAGAAATAGGAGAAGGGGGGGGG - Intergenic
1071231985 10:83598550-83598572 CAGAAAAATGAGAATGTGTGTGG - Intergenic
1071499624 10:86194076-86194098 CAGAGAAAGGAGAAGTGTTCTGG - Intronic
1071503516 10:86219543-86219565 CAGAGCAGGGAGAAGGGGAGCGG - Intronic
1071710858 10:88047833-88047855 CAGAGAAAGGAAAAGGAAAGGGG - Intergenic
1071807741 10:89142766-89142788 AAGAGAAAGGAGAAGGGGAGGGG + Intergenic
1072431396 10:95374706-95374728 GAGAGAAAGGAGAAGAAATGAGG + Intronic
1072800186 10:98387323-98387345 CAGAGAAATGAGATGGTGTTAGG + Intronic
1073007154 10:100333266-100333288 CAGAGGAGGGGGAAGGCCTGAGG + Intergenic
1073308478 10:102522427-102522449 GAGAGAAAGGAGGAGGCGTGTGG - Intronic
1073466761 10:103698804-103698826 CAGAGAAAAGAGAGGTCCTGGGG + Intronic
1074149985 10:110750488-110750510 CAGAGAAGGAAGAACGCGTGGGG + Intronic
1074538108 10:114343470-114343492 GAGACAAAGGAGCAGGGGTGAGG - Intronic
1075334832 10:121601069-121601091 AAGAGAAAGGAGAAGGGGGTGGG + Intergenic
1076050464 10:127329341-127329363 GAGAGGAAGGAGGAGGCCTGAGG + Intronic
1076165655 10:128280514-128280536 CAGAGAAGTGAGAAGGTGGGAGG - Intergenic
1076242304 10:128917547-128917569 TAGAGGGAGGAGAAGGGGTGAGG + Intergenic
1076304952 10:129459548-129459570 CAGAGAAATGAGAAGTCCAGGGG + Intergenic
1076482972 10:130796851-130796873 CAGAGGAAGAAGAAGACCTGAGG - Intergenic
1076757894 10:132583676-132583698 CAAATAAAGGAGAAAGTGTGGGG - Intronic
1077285393 11:1763239-1763261 CTGAGAGAGGAGGAGGCATGGGG - Intronic
1077495855 11:2886163-2886185 CAGACAAAGGAGCCGGCGGGGGG - Intergenic
1078001860 11:7503254-7503276 CAAAGAAAAGAGGAGGCCTGAGG + Intronic
1078720193 11:13877246-13877268 CTGAGAAAGGAAAAGAGGTGAGG - Intergenic
1078738707 11:14046254-14046276 TAGAGAAAGGAGTAGGGTTGGGG - Intronic
1078744032 11:14094256-14094278 CAAAGAAAGGAGACGGGTTGAGG - Intronic
1079119950 11:17674913-17674935 CAGAGAAAGAAGAAGCCTGGAGG + Intergenic
1079727417 11:23892625-23892647 CAGTGAAGGGAGATGGTGTGGGG + Intergenic
1080227058 11:29973673-29973695 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
1080318406 11:30977162-30977184 CAGAGACTGGAAAAGGTGTGTGG + Intronic
1080772956 11:35359790-35359812 CAGAGAAAGGAGTAAGAGTTGGG - Intronic
1080907996 11:36566128-36566150 CAAAGAATGGTGAAGGTGTGAGG - Intronic
1080994604 11:37583164-37583186 CAGTGAAGGGAGATGGGGTGGGG + Intergenic
1081354809 11:42099565-42099587 GAGAGCAAGGAGAAGGAGAGTGG + Intergenic
1081403793 11:42672867-42672889 CAGAGAAAGCAGAAGTCACGAGG - Intergenic
1081728972 11:45355264-45355286 CTGAGAAAGGAGAGGGAGGGGGG + Intergenic
1081871079 11:46382751-46382773 CAGCGAAAGGAGAAGGGGGTGGG + Intronic
1081931654 11:46875685-46875707 CAGAGGAAGGAGAGGGTGGGGGG + Intronic
1082082009 11:48019372-48019394 CAGAGAAAGGAGGTGGGGTTCGG - Intronic
1082711192 11:56555546-56555568 CAGCGAAAGGAGAATGTATGAGG + Intergenic
1083049154 11:59761632-59761654 CTGAGAGAGGAGATGGGGTGGGG - Intronic
1083179835 11:60978204-60978226 CAGAGAAAGGACAAAGGGGGTGG + Intronic
1083372157 11:62190681-62190703 CAGAGATAGGAGGAGGCGCGGGG - Intronic
1083902677 11:65651210-65651232 TAGAGAGAGGACAAGGCCTGGGG - Intergenic
1084231973 11:67759972-67759994 CAGTGAAGGGAGATGGGGTGGGG - Intergenic
1084245886 11:67856713-67856735 CAGTGAAGGGAGATGGGGTGGGG + Intergenic
1084356034 11:68639320-68639342 CAGTGAAGGGAGATGGGGTGGGG - Intergenic
1084452912 11:69250721-69250743 AAAGGAAAGGAGAAGGGGTGCGG - Intergenic
1084826785 11:71737801-71737823 CAGTGAAGGGAGATGGGGTGGGG - Intergenic
1084903705 11:72329676-72329698 CAGGGAAGGGAGGAGGCCTGTGG - Intronic
1085520025 11:77132242-77132264 CAGAGAAAGGAGGAGGACTGTGG - Intronic
1085811485 11:79686520-79686542 AAGAGACTGGAGAAGACGTGTGG - Intergenic
1086004756 11:82025735-82025757 CAGTGAAGGGAGATGGGGTGGGG - Intergenic
1086136602 11:83448287-83448309 CAGTGAAGGGAGATGGGGTGGGG + Intergenic
1086219009 11:84419113-84419135 TACAGAAAAGAGAAGGCGAGAGG + Intronic
1086911925 11:92482614-92482636 CTGAGAAAAGAGAAAGCATGTGG - Intronic
1087197751 11:95317678-95317700 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
1087583989 11:100094734-100094756 CAGGGAAAGAAGAAGGAGGGAGG + Intronic
1088680009 11:112231887-112231909 CAGAGACAGGAGAAGAGGAGGGG + Intronic
1089560285 11:119340188-119340210 GAGAGAAAGGCGAGGGCGGGAGG - Exonic
1089874632 11:121708150-121708172 CAGAGAGAGGAGATGGAGTCAGG - Intergenic
1090480277 11:127061760-127061782 CAAAGAAAGGAGAAGGGGGAAGG - Intergenic
1090546806 11:127774602-127774624 CAGCGAAGGGAGATGGGGTGGGG + Intergenic
1090933909 11:131324749-131324771 CAGAGATAGGAGGGGACGTGAGG + Intergenic
1091314666 11:134605080-134605102 CAGAGAAGGAACAAGGGGTGGGG + Intergenic
1091446704 12:547910-547932 AAGAGCAAGGAGAAGGGATGAGG + Intronic
1091769611 12:3142397-3142419 CAGGGAAGGGAGGAGGCGAGAGG - Intronic
1092475209 12:8813212-8813234 CAGTGAAGGGAGATGGGGTGGGG - Intergenic
1092593044 12:9968371-9968393 CAGCGAAGGGAGATGGGGTGGGG + Intronic
1092789380 12:12058659-12058681 CAGTGAAGGGAGATGGGGTGGGG - Intronic
1093025208 12:14239514-14239536 CAGAAAGAGGAGCAGGCGTAGGG + Intergenic
1093312268 12:17603705-17603727 CAGTGAAGGGAGATGGGGTGGGG - Intergenic
1093705080 12:22266129-22266151 GAAAGTAAGGAGAAGGGGTGAGG - Intronic
1094401266 12:30062394-30062416 CAGGGAAGGGAGATGGGGTGGGG - Intergenic
1096323255 12:50634251-50634273 CAGAGAAGTTAGAATGCGTGTGG - Intronic
1097166190 12:57087843-57087865 CAGGGAAAGGAGGGGGGGTGGGG - Intronic
1098525207 12:71479756-71479778 CTGAGAAAGGAAAGGGCTTGGGG + Intronic
1098949496 12:76624740-76624762 AAGAGAAAGAAGCAGGCATGTGG + Intergenic
1099120750 12:78686549-78686571 AAGAGGAAGAAGAAGGCTTGTGG + Intergenic
1099835601 12:87907389-87907411 CAGTGAAGGGAGATGGGGTGGGG + Intergenic
1100407058 12:94280878-94280900 CAGAGCAAGGAGGGGGCCTGGGG + Intronic
1100561838 12:95754765-95754787 CAGTGAAGGGAGATGGGGTGGGG - Intronic
1101045159 12:100797771-100797793 GAGAGAAAGCAGAAGGCAAGAGG - Intronic
1101409909 12:104458814-104458836 CAGTGAAAGGAGAAGGCGGGAGG - Intronic
1101968379 12:109296039-109296061 CAGAGAAAGGGGAAGAGGAGAGG - Intronic
1101973585 12:109335299-109335321 CAGAGCAGGGAGCAGGTGTGGGG + Intergenic
1102208701 12:111108658-111108680 CAGAGAGGGGAGATGGGGTGGGG - Intronic
1102262008 12:111448589-111448611 TAGAGAAAGGAGTTGGGGTGAGG + Exonic
1102679816 12:114683867-114683889 CAGAGGAAGGAGGAGGAGGGCGG - Intronic
1102983723 12:117262448-117262470 CAGAGAGAGGAGAGGGAGGGAGG + Intronic
1103261612 12:119593704-119593726 CAGAGGACGCAGAAGGGGTGAGG + Exonic
1103918649 12:124388515-124388537 GAGAGAGAGGAGAGGGCATGGGG + Intronic
1104301430 12:127568575-127568597 GAGAGAGAGGAGAAGGAGAGAGG + Intergenic
1104451875 12:128875876-128875898 CAGAGAAAGGAGAAGATGAGGGG - Intronic
1105572846 13:21620348-21620370 AAGAGAAAGGAGAAGGAGATTGG - Intergenic
1105578608 13:21674337-21674359 CAGGGAAAGGAGTGGGGGTGGGG + Intronic
1106643175 13:31607434-31607456 CAGTGAAGGGAGATGGGGTGGGG + Intergenic
1108185262 13:47882278-47882300 AAGAGCAGGGAGAAGGCATGGGG - Intergenic
1108701501 13:52948023-52948045 CAGAGACACCAGCAGGCGTGGGG + Intergenic
1108832302 13:54495082-54495104 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
1108879213 13:55088580-55088602 CAGAGAAAGGAGAAAGGGTTTGG - Intergenic
1108952303 13:56110308-56110330 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
1109049322 13:57458276-57458298 AAGAGCAAGGAGAAGGGATGAGG + Intergenic
1109282409 13:60372260-60372282 CAGAGACAGGAGAAAGCGGTAGG - Intergenic
1109499817 13:63219009-63219031 CAGTGAAGGGAGATGGGGTGGGG - Intergenic
1110267721 13:73557476-73557498 CAGAGAAAGGCTGAGGCGGGGGG - Intergenic
1110408859 13:75182416-75182438 GACAGACAGGAGAAGGAGTGGGG - Intergenic
1112083378 13:96001426-96001448 CAGCGAAGGGAGATGGGGTGGGG - Intronic
1112374531 13:98826366-98826388 CAGAGGAAGGAGAGGGGGCGAGG - Intronic
1112697173 13:101963296-101963318 CAAAGAAAGAAGAAAGGGTGGGG - Intronic
1112844680 13:103625549-103625571 CAGAGAAAGGAGAATGACTTTGG - Intergenic
1112921426 13:104617158-104617180 CATATAAAAGAGAAGGTGTGTGG - Intergenic
1113323935 13:109265397-109265419 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
1113552088 13:111200375-111200397 GAGAGAAAGGTGAAGGTGAGTGG - Intronic
1113618064 13:111695039-111695061 CAGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113623597 13:111780300-111780322 CAGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113716322 13:112510751-112510773 CAGAGACAGGTGATGGGGTGGGG + Intronic
1114598547 14:23935006-23935028 AAGAGAAAGGAGAAGGTGCCAGG + Intergenic
1115161397 14:30399601-30399623 CAGAGAAAGATGAAGGCCAGAGG + Intergenic
1115305258 14:31927372-31927394 CAGTGGAAGGAGAAGGAGTTGGG - Intergenic
1115587263 14:34827069-34827091 GAGAGATAGGAGAAGGGATGGGG - Intronic
1116704397 14:48278571-48278593 CAGCGAAGGGAGACGGGGTGCGG + Intergenic
1118621776 14:67620266-67620288 CAGAGAATGGAGAGGGAGGGAGG + Intronic
1118894238 14:69932402-69932424 CAGGGACAGGAGGAGGCATGTGG - Intronic
1119384937 14:74252150-74252172 CAGAGACAAGAGGAGGTGTGAGG + Intronic
1119390944 14:74290506-74290528 CAGAGAAGAGAGGGGGCGTGAGG + Intronic
1119391807 14:74295998-74296020 GAGAGAAGGGAGAGGGTGTGGGG + Intronic
1119491045 14:75033754-75033776 GAGAGAAACTAGAAGGGGTGGGG - Intronic
1119647621 14:76359720-76359742 CAGGGAAAGCAGAGGGCTTGTGG + Intronic
1119779617 14:77269500-77269522 CAGAGCCAGTAGAAGGCATGAGG - Intronic
1120395429 14:83961865-83961887 CAGTGAAGGGAGATGGGGTGGGG - Intergenic
1120556526 14:85934546-85934568 CAGAAAAAGGAAAAGGGGAGGGG + Intergenic
1121263081 14:92580749-92580771 AAGAGCATGGAGAAGGCTTGTGG + Intronic
1121905790 14:97741542-97741564 GAGAGGAAGGAGAAGCAGTGTGG - Intergenic
1122059910 14:99130126-99130148 CAGGGGAAGGAGAGGGCGTGGGG - Intergenic
1122799702 14:104223414-104223436 CAGAGAAAGGAGGAGGCAGCTGG - Intergenic
1124270031 15:28271815-28271837 CTGAGGGAGGAGCAGGCGTGCGG - Intronic
1124587637 15:31024390-31024412 CAGAAAGAGGAGAAGGCTTGAGG - Intronic
1124904708 15:33857742-33857764 CAGAGAAAGGAAAAGGAGTGGGG - Intronic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1126580191 15:50235842-50235864 CAGAGCAAGGGGTAGGGGTGGGG - Intronic
1126810177 15:52394470-52394492 GTGAGAAAGGAGAAAGCTTGAGG + Intronic
1126843415 15:52738864-52738886 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
1126962124 15:54008712-54008734 CAGAGAGAGGAGTAGGTATGTGG + Intergenic
1127733578 15:61821350-61821372 CAGAAATAGGAGAAGGCATCAGG - Intergenic
1128091866 15:64924555-64924577 CAGCGAAAGGAGAAAGCTTTAGG - Intronic
1129306412 15:74667420-74667442 GAAAGAAAGGAGAAGGGGGGAGG + Intronic
1129448331 15:75634454-75634476 CATAGAAAGGAGATGGAGGGAGG + Intergenic
1129648277 15:77458934-77458956 CACAGAAAGGAGAAGGGGGTGGG - Intronic
1130751433 15:86717207-86717229 GAGAACAAGGAGAAGGAGTGGGG + Intronic
1131557654 15:93413722-93413744 CAGAGAAAGGAGAAGCTGCTGGG - Intergenic
1131570500 15:93530314-93530336 CAGAGAAAACAGTGGGCGTGAGG + Intergenic
1131821174 15:96275524-96275546 CAGAAAAAGAAGGAAGCGTGTGG - Intergenic
1133421091 16:5647564-5647586 AAGGGAAAGGAGAAGAGGTGGGG - Intergenic
1134322552 16:13176839-13176861 CAGAGAGGGGAGAAGAGGTGTGG - Intronic
1136293489 16:29289494-29289516 CAGAGGGAGGGGCAGGCGTGTGG + Intergenic
1137341658 16:47613235-47613257 CAGCAAAAGGAAAAGGCATGGGG + Intronic
1137594561 16:49715120-49715142 CAGAGACAGGAACAGGCATGAGG + Intronic
1137966570 16:52940055-52940077 CAGAAAAGGGAGAAGGCCTATGG - Intergenic
1138660718 16:58515603-58515625 CTGCGAACGGAGAAGGGGTGAGG - Intronic
1139003524 16:62542779-62542801 CAGAGAAAGGTGAAGGTGAAAGG + Intergenic
1140518259 16:75560220-75560242 CAGTGTCAGGAGATGGCGTGAGG + Intergenic
1141393322 16:83682644-83682666 CAGAGGAAGGAGGAGGAGTGAGG - Intronic
1141598383 16:85111121-85111143 GAGGGAAAGGAGAGGGCGTGAGG - Intronic
1141839307 16:86564453-86564475 CAAAGAAAGGAAAAGGGGAGGGG - Intergenic
1142099369 16:88263500-88263522 CAGAGGGAGGGGCAGGCGTGTGG + Intergenic
1142131977 16:88435290-88435312 CAGAAAAAAGAGAAGGCCGGAGG + Exonic
1142374027 16:89697677-89697699 GAGAGGAAGGAGAAGGCGGAAGG + Exonic
1142442340 16:90106905-90106927 CAGAGAAGGGAGAAACCCTGAGG + Intergenic
1142699400 17:1649938-1649960 CGAGGAAGGGAGAAGGCGTGGGG + Exonic
1143255902 17:5557960-5557982 CAGAGAGAGGAGCAGGGGTAGGG + Intronic
1143594661 17:7907141-7907163 GTGAGAAAGGAGAAGGCATAAGG + Exonic
1143629062 17:8126706-8126728 CAGAGCCAGGAGGAGGCGAGCGG - Intergenic
1144257761 17:13486464-13486486 CAGAGGCAGGAGAAGGCAGGAGG + Intergenic
1145110904 17:20160333-20160355 TCGGGAGAGGAGAAGGCGTGTGG + Intronic
1145991721 17:29083062-29083084 CAGAGAAAGGAAAAGGGGCGGGG + Intronic
1146455220 17:33004425-33004447 AAGAGAAAGGGGAAGGTGTGAGG + Intergenic
1146667510 17:34714968-34714990 CAGAGAAAGAAGAATGGGTAGGG + Intergenic
1147051987 17:37802170-37802192 CAGAGCAAGGAGAGGGGGAGAGG - Intergenic
1147323940 17:39661490-39661512 CAGAGAAAGATGACGGAGTGAGG - Intronic
1147339919 17:39747121-39747143 CAGAGCTAGGAGAAGGAGAGGGG - Exonic
1147699646 17:42384937-42384959 CAGAGAAAGGAGAGGTTATGAGG - Intronic
1147808340 17:43148401-43148423 CAGCAAAAGGAGATGGGGTGGGG + Intergenic
1147966202 17:44195524-44195546 CAGAGAAAAGAGAAGGACAGGGG + Intronic
1148357123 17:46982896-46982918 CGGAAAAAGGAGAAGGCTTCAGG + Intronic
1148676559 17:49448892-49448914 GAGAGAAGGGAGAAGGGGTGAGG + Intronic
1149879845 17:60278467-60278489 TAGGGAAAGGAAAAGGAGTGTGG + Intronic
1150502032 17:65660286-65660308 GAGAGAAAAGAGAAGGAGGGAGG - Intronic
1150562853 17:66309809-66309831 CAGAGAAAGGAGAAGAAGACAGG + Intronic
1151412437 17:73940175-73940197 CAGAGAAGGGGGAAGGAGGGAGG + Intergenic
1151652889 17:75481058-75481080 CACAGACAGGAGAAGGCCTATGG + Intronic
1152032800 17:77854399-77854421 GAGGGAAAGGAGAAGGCGCTGGG + Intergenic
1154191364 18:12233553-12233575 CAGAGAAAATAGCAGGCGTGTGG - Intergenic
1155074451 18:22342382-22342404 CAGAGAGAGGAGAAGCAGAGAGG + Intergenic
1155728134 18:29115747-29115769 GAGAGAAAAGAGAAGAGGTGAGG - Intergenic
1155838138 18:30613002-30613024 CAGCGAAAGGAGATGGGGTGGGG - Intergenic
1156302836 18:35850303-35850325 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
1156471311 18:37378774-37378796 CAGAGGAAGGAGTAGCTGTGGGG + Intronic
1156720782 18:40067410-40067432 CAGAGAATGGGGAAGGGCTGAGG + Intergenic
1156957977 18:42991836-42991858 CAGCGAAGGGAGATGGGGTGGGG - Intronic
1156985172 18:43342259-43342281 CAGAGAAAGGATCAGGAATGGGG - Intergenic
1157006959 18:43594716-43594738 CACAGAAAGGAGACCCCGTGAGG - Intergenic
1157257238 18:46150174-46150196 TAGAGGAAGGAGAAGGGCTGGGG - Intergenic
1157687009 18:49650807-49650829 CAGTGAAAGGAGAAGACCTCAGG - Intergenic
1157728378 18:49982982-49983004 CAGAGAAAGGAGAAGATCTCTGG - Intronic
1157896152 18:51470288-51470310 CAGCGAAGGGAGATGGGGTGGGG + Intergenic
1157947923 18:52002081-52002103 CAGGGAAAGGAGATGGCATGAGG - Intergenic
1158336016 18:56415762-56415784 CAGTGAAGGGAGATGGGGTGGGG - Intergenic
1158336844 18:56421220-56421242 CAGTGAAGGGAGATGGGGTGGGG - Intergenic
1158409084 18:57188509-57188531 CAGAGAAAGGAGAGCGAGAGAGG + Intergenic
1158543459 18:58376886-58376908 AAGAGAAAGCAGAGGGCCTGAGG - Intronic
1159132293 18:64292672-64292694 CAGAGAGAGGAGAAGGGGTAAGG - Intergenic
1159164153 18:64682008-64682030 CAGTGAAGGGAGATGGGGTGGGG - Intergenic
1159834704 18:73324922-73324944 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
1159954270 18:74508181-74508203 CAGAGGATGGAGGAGGCGTGGGG + Intronic
1160002047 18:75033864-75033886 CAGGGAAAGGAGAAGGGAAGAGG - Intronic
1160839713 19:1140630-1140652 CAGAGAGCGGGGAAGGGGTGGGG + Intronic
1161035154 19:2080269-2080291 CAGAGAGGGGAGAGGGAGTGAGG + Intronic
1161776986 19:6269012-6269034 CAGAGAAAAGGGGAGGGGTGAGG + Intronic
1162920041 19:13895559-13895581 CAGAGGAAGATGAAGGGGTGGGG + Intronic
1163176025 19:15564466-15564488 GAGAGAAAGAAAAAGGCCTGGGG - Intergenic
1163183763 19:15622191-15622213 CAGAGAAGGGAGCAGGGCTGGGG - Intronic
1164826872 19:31290382-31290404 CAGAGAGAGGAGATGGCAGGGGG + Intronic
1164849526 19:31470076-31470098 AAGATAAAGGAGAAGGCAGGTGG + Intergenic
1165673982 19:37705824-37705846 GAGAGAAGGGAGCAGGGGTGGGG - Intronic
1165757232 19:38300999-38301021 CAGAGAGAGCAGAAGGAGAGAGG - Intronic
1165782606 19:38442812-38442834 AGGAGAAAGGAGCAGGCGTCGGG - Intronic
1167281654 19:48572752-48572774 CAGGGAGAGGAGAAGGCCTGAGG + Intronic
1167353138 19:48988135-48988157 CAGAGAAAGGAGGCAGCGAGTGG - Intronic
1167424182 19:49421439-49421461 AAGAGAAAGGAGCAGGCGTCAGG - Intergenic
1167847732 19:52178279-52178301 CAGAGAAGGGAGATGGGGTGGGG - Intergenic
1167901698 19:52627190-52627212 CAGCAAAAGGAGATGGGGTGGGG - Intronic
1167902617 19:52633272-52633294 CAGCGAAGGGAGATGGGGTGGGG - Intronic
1167935718 19:52905382-52905404 CAGGGAAGGGAGATGGGGTGGGG - Intergenic
925065872 2:928530-928552 CAGATGAAGGAGGAGGCCTGTGG + Intergenic
925065909 2:928731-928753 CAGATGAAGGAGGAGGCCTGTGG + Intergenic
925065921 2:928798-928820 CAGATGAAGGAGGAGGCCTGTGG + Intergenic
925186114 2:1847540-1847562 CAGGTGAAGGAGAAGGCCTGGGG + Intronic
925515087 2:4673221-4673243 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
925810607 2:7696678-7696700 CAGCGAAGGGAGATGGGGTGGGG + Intergenic
925829548 2:7881085-7881107 CAGAGAAAGAAGTATGTGTGTGG + Intergenic
925870425 2:8265327-8265349 CAGAGAAAGGAGAGAGCTTGGGG - Intergenic
926408237 2:12575314-12575336 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
926672988 2:15592353-15592375 CAGAGAGGCGAGACGGCGTGGGG + Intronic
927031776 2:19127759-19127781 CAGAGAAAGAGGCAGGTGTGAGG + Intergenic
927990057 2:27441655-27441677 CTGAGAGAAGAGAAGGCATGGGG - Intronic
928132793 2:28665298-28665320 CAGAGGAAGGGGAGGGCCTGTGG - Intergenic
929052108 2:37846412-37846434 CAGAGAGAGGAGAAAGAGAGAGG - Intergenic
929230966 2:39559854-39559876 CTGAGAAAGGTGAATGAGTGGGG - Intergenic
930113429 2:47698380-47698402 CAGCGAAGGGAGATGGGGTGGGG + Intronic
930429945 2:51263135-51263157 CAGTGAAGGGAGATGGGGTGGGG + Intergenic
930590572 2:53321973-53321995 CAGAGTAAAGAGAAGAAGTGTGG - Intergenic
930621896 2:53652525-53652547 GAAAGAAAGGAGATGGGGTGGGG + Intronic
930891335 2:56391560-56391582 CAGAGGAAGAAGAAGACTTGAGG + Intergenic
931079081 2:58748977-58748999 CAGATACAGGAGAATGAGTGGGG + Intergenic
931090792 2:58883786-58883808 CAGAGAAATGAGAGAGAGTGGGG + Intergenic
931098979 2:58974043-58974065 CAGAGCAAGGTGAAGGTGTCTGG + Intergenic
931622648 2:64226757-64226779 CAGAGCAAGAGGAAGGCGAGAGG - Intergenic
932300570 2:70664070-70664092 CAGAGAAAGGAGAAGGCGTGAGG + Intronic
932433104 2:71687042-71687064 CCGAGTAAGGAGAAGGCAGGGGG - Intergenic
932439174 2:71721025-71721047 CAGAGAGAGGAGAAGAGGAGTGG - Intergenic
932555380 2:72819489-72819511 CAGAGAAAGGAGGAGGAGATAGG - Intronic
934160548 2:89245263-89245285 CACAGAAAGGGGATGGTGTGGGG - Intergenic
934206729 2:89937175-89937197 CACAGAAAGGGGATGGTGTGGGG + Intergenic
934708933 2:96502922-96502944 CAGAGAAAGGGGAACCCCTGGGG + Intronic
934892815 2:98085749-98085771 TAGGGAAAGGAGCAGGCATGGGG + Intergenic
934986019 2:98885055-98885077 CATAGAAAGGTGTAGGAGTGTGG + Intronic
935457697 2:103289149-103289171 CTGAGAAAAGAGAAGACCTGAGG + Intergenic
936387119 2:112040552-112040574 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
936505517 2:113102630-113102652 CAGCGAAGGGAGATGGGGTGGGG + Intergenic
936589081 2:113785724-113785746 CAGAAGAAGGAAAAGGAGTGAGG - Intergenic
936794662 2:116190643-116190665 CAGGGAAGGGAGATGGGGTGGGG + Intergenic
936821011 2:116521046-116521068 CAGCAAAAGGAGATGGAGTGCGG - Intergenic
937110583 2:119364063-119364085 CAGAGATAGGAGAAAGGGGGAGG + Intronic
937129133 2:119494212-119494234 CAGAGAAAGGAAGAGTGGTGAGG + Intronic
937768812 2:125694930-125694952 CAGGGAGAGAAGAAGGAGTGAGG + Intergenic
938057593 2:128228356-128228378 CAGAGAAAGGAAAAAGAGAGAGG + Intergenic
938299288 2:130198746-130198768 CAGGGAGAGGAGCAGGCCTGGGG - Intergenic
938305164 2:130248303-130248325 CCCAGAAGGGAGAAGGGGTGTGG - Intergenic
938721558 2:134071569-134071591 GAGAGAAAGGAGCAAGCATGAGG - Intergenic
938947754 2:136228415-136228437 GAAAAAAAGGAGGAGGCGTGAGG + Intergenic
939177188 2:138762083-138762105 GGGAGAAAGGAGCAGGTGTGAGG + Intronic
939318732 2:140587259-140587281 CAAGGAGAGGAGAAAGCGTGGGG + Intronic
939428250 2:142069055-142069077 CAGAGAAGGGAGAAGGGTGGAGG - Intronic
939766624 2:146258079-146258101 CAGAGAAAGAAGAAGGGGTTTGG - Intergenic
940107873 2:150118442-150118464 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
940219383 2:151335847-151335869 CAGGGAAAGGAGAAGGGCGGTGG - Intergenic
940904970 2:159160922-159160944 GAGAGGAAGGAAAAGGGGTGGGG - Intronic
941258951 2:163272262-163272284 CAGAGACAGGAGAAAAAGTGTGG - Intergenic
941918747 2:170828917-170828939 CAGAGAGATGAGGAGGGGTGAGG - Intronic
941920829 2:170849254-170849276 CAGAGAAAGGAGAGGAAGAGGGG - Intronic
942350249 2:175045189-175045211 GAGAGAAAGGAGGAGGGGAGGGG - Intergenic
942619146 2:177829177-177829199 CAGAGAGAGGAGCAGGCTTGGGG + Intronic
942899377 2:181095759-181095781 CAGAGAAAGGGGAAGCTGTCAGG - Intergenic
944224226 2:197334055-197334077 CAGAAAAAGGAGCAGGTTTGGGG + Intergenic
944264578 2:197709425-197709447 CAGCGAAGGGAGATGGGGTGGGG + Intronic
944425702 2:199580497-199580519 GAGAGCAAGGAGAAGGCTAGTGG - Intergenic
944875642 2:203962043-203962065 CAGCGAAGGGAGATGGGGTGGGG + Intergenic
944876464 2:203967377-203967399 CAGCGAAGGGAGATGGGGTGGGG + Intergenic
945582377 2:211611312-211611334 CAGAAAAAGGAAAAGGGGAGGGG + Intronic
946144427 2:217718339-217718361 CAGAGAGAGGAGAAGAAGGGAGG - Intronic
946871207 2:224087454-224087476 CAGTGAAGGGAGATGGGGTGGGG + Intergenic
946916957 2:224532980-224533002 CAGAGAAAAGAGAAAGCATCAGG - Intronic
946970600 2:225086743-225086765 AACAGAAAGCAGAGGGCGTGAGG - Intergenic
947247080 2:228060805-228060827 CAGAGAAAGGGGGAGAGGTGAGG + Intronic
947461924 2:230310868-230310890 AGGGGAAAGGAGAAGGCTTGGGG - Intronic
947471008 2:230401080-230401102 AGGGGAAAGGAGAAGGCTTGGGG - Intronic
948058776 2:235028715-235028737 CAGAGAAAGAGGATGGGGTGAGG + Intronic
948684126 2:239659444-239659466 CAGAGGAAGGGGAAGGTGTGAGG - Intergenic
948859718 2:240746911-240746933 CAGAGAAGGGAGACAGGGTGGGG + Intronic
1170940679 20:20845625-20845647 CAGGGAAAGGAGATGGGGAGAGG + Intergenic
1171327733 20:24310544-24310566 CAGAGGAAGCAGCAGGAGTGTGG + Intergenic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1174001489 20:47378228-47378250 AAGATCAAGGAGGAGGCGTGGGG + Intergenic
1174401255 20:50277167-50277189 CAGAGAAGGGAGAGGCAGTGAGG - Intergenic
1174462400 20:50691906-50691928 GAGGGAAAGGAGAAAGAGTGAGG - Intergenic
1174581720 20:51576940-51576962 CAGAAGAAGGGGAAGGGGTGGGG - Intergenic
1174583573 20:51590660-51590682 CAGACAAAGGAGAAGGCAAAGGG - Intergenic
1175290003 20:57869429-57869451 TAGAGGAAGGAGAAGGCAAGGGG - Intergenic
1175754859 20:61523024-61523046 CAGAGGAAGGAGCAGGAGGGAGG + Intronic
1175991740 20:62793294-62793316 CTCAGAAAGGAGGGGGCGTGTGG + Intergenic
1176039388 20:63056341-63056363 CAGGGAAGGGGGAAGGGGTGTGG - Intergenic
1176296363 21:5075514-5075536 CCGAGAAAGGATGAGGGGTGGGG - Intergenic
1176685830 21:9847780-9847802 CAGTGAAGGGAGATGGGGTGGGG - Intergenic
1176983805 21:15412802-15412824 CAGAGAAAGGAGAAAGCTCCAGG + Intergenic
1179479655 21:41669219-41669241 CAGAGGGAGGAGGAGGCCTGCGG + Intergenic
1179860686 21:44186607-44186629 CCGAGAAAGGATGAGGGGTGGGG + Intergenic
1181413687 22:22744742-22744764 GAGAGTATGGAGAAGGCCTGAGG + Intronic
1181450668 22:23017909-23017931 CAGAAAAAGGACGAGGCGTGTGG + Intergenic
1181776221 22:25161751-25161773 CAGGAAAAGGAGAAGGGGAGGGG - Intronic
1182134223 22:27886023-27886045 CTGAGGATGGAGAGGGCGTGAGG + Intronic
1182893009 22:33834560-33834582 CAGCGAAGGGAGATGGGGTGGGG - Intronic
1182998340 22:34834899-34834921 CAGTGAAGGGAGATGGGGTGGGG - Intergenic
1183184137 22:36282210-36282232 CAAAGAAAGGAGGAGGAGTGGGG + Exonic
1183464328 22:37972070-37972092 GAGAGAAAGGAGAGGGGGAGGGG + Intronic
1183731152 22:39619284-39619306 CAGAGAAAGGAGAGAGAGTGAGG - Intronic
1183733335 22:39630234-39630256 CAGAGAAGGGAGAAAGGGTTGGG - Intronic
1184300264 22:43554591-43554613 CAGGGAAGGGAGAAGGAGTGTGG + Intronic
1184508545 22:44918538-44918560 CTGAGAAAGGAGAGAGGGTGGGG - Intronic
1185071412 22:48658786-48658808 GAGAGAAAGGACCAGGCCTGTGG + Intronic
949947074 3:9198738-9198760 GAGAGAAAGGACAAGGCCTCTGG - Intronic
950311336 3:11960972-11960994 CAGAGAACGGAGGAGGCAGGAGG + Intergenic
950406583 3:12808848-12808870 CAGAGACAGGGGAAGACTTGGGG + Intronic
951731208 3:25812342-25812364 CAGAGAAAGGATGAGGCAAGAGG - Intergenic
952895584 3:38076391-38076413 CAGTGAAGGGAGATGGGGTGGGG + Intronic
952896855 3:38083278-38083300 CAGCGAAGGGAGATGGGGTGGGG + Intronic
953863705 3:46565924-46565946 GCGAGAAAGGAGAGAGCGTGGGG - Intronic
954924498 3:54220609-54220631 CAGAGGAAGCAGCAGGTGTGGGG - Intronic
955253076 3:57304135-57304157 CAGTGAAGGGAGATGGGGTGGGG - Intronic
955307450 3:57848549-57848571 AAGAAAAAGGAGAAGGAGGGAGG - Intronic
955500950 3:59582314-59582336 CAGATGGAGGAGAAGGGGTGAGG - Intergenic
955698227 3:61657672-61657694 CAAAGAAAGTTGAAGGCATGAGG - Intronic
956929587 3:74027939-74027961 CAGAGAGAGGATCAGGGGTGAGG + Intergenic
957255281 3:77827923-77827945 CAGCAAAAGGAAAAGGTGTGTGG + Intergenic
957362814 3:79181174-79181196 CAGAGAGAAGAGAGGGTGTGAGG - Intronic
957369725 3:79277641-79277663 CAAAGAAAGGAAAATGCTTGAGG + Intronic
957471666 3:80667030-80667052 CACAGAAATGAGAAGGAATGAGG + Intergenic
958015487 3:87935249-87935271 GAGAAAAAGGAGAGGGAGTGTGG + Intergenic
960540064 3:118851904-118851926 CAGAAAAAGGAAAAGGGGAGGGG + Intergenic
961476540 3:127150300-127150322 CAGAGAGATGAGATGGCTTGTGG + Intergenic
961854434 3:129855512-129855534 CAGAAAAAGGAGAAGAAATGAGG + Intronic
961894010 3:130152442-130152464 CAGTGAAGGGAGATGGGGTGGGG + Intergenic
962370437 3:134816938-134816960 CAGAGCAAGGAAAGGGCCTGTGG + Intronic
962386414 3:134936124-134936146 CAGAGAATGGAGCTGGGGTGGGG + Intronic
962840142 3:139225630-139225652 CAGGGAGAAGGGAAGGCGTGAGG + Intronic
963327347 3:143877129-143877151 GAGGAAAAGGAGAAGGTGTGGGG - Intergenic
963638040 3:147824085-147824107 CACAGAAAGGAGCAGGGGAGTGG - Intergenic
963684802 3:148419973-148419995 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
963863623 3:150336219-150336241 TAGAGAAAGGGGAAGGAGAGTGG - Intergenic
963955680 3:151251127-151251149 CAGAGAAAGGCAAAAGCATGGGG - Intronic
964414673 3:156434793-156434815 CTGAGAAAGAAGAAGGAGTTGGG + Intronic
966016546 3:175146284-175146306 CAGAAAAAAGAGAAGGACTGTGG + Intronic
966182517 3:177199631-177199653 TAGGGGAAGGAGAAGGGGTGGGG - Intergenic
966490467 3:180522482-180522504 CAGAGAATGGGGAGGGCGGGAGG + Intergenic
967151800 3:186658051-186658073 CAGTGAAGGGAGATGGGGTGGGG - Intergenic
967152598 3:186663569-186663591 CAGAGAAGGGAGATGGGGTGGGG - Intronic
967778113 3:193405614-193405636 AAGAGAAAGGTGAAAGAGTGTGG + Intronic
968041419 3:195592257-195592279 GAGAGAAAGGAGAAGGAGGGAGG + Intergenic
968362612 3:198157869-198157891 CAGAGAAGGGAGAAACCCTGAGG + Intergenic
968648210 4:1750175-1750197 CAGAGAGAGGAGGGGGCGGGGGG + Intergenic
968849572 4:3069822-3069844 CTGAGAGAGGAGCAGGTGTGAGG - Intergenic
969003332 4:4000192-4000214 CAGCGAAGGGAGATGGGGTGGGG + Intergenic
969436569 4:7192525-7192547 CAGAGAAAGGAGCCGGCGAGGGG - Exonic
969667012 4:8564927-8564949 CAAACAAAGGAGAGGGCGTGGGG - Intronic
969810600 4:9644632-9644654 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
970087264 4:12364145-12364167 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
970095677 4:12460640-12460662 CAGTGAAGGGAGATGGGGTGGGG - Intergenic
970852535 4:20618170-20618192 CAGACAAAGGAGAAGGAGGAAGG - Intronic
971130065 4:23798125-23798147 CAGAGAAGGGAGATGGGGTGGGG - Intronic
971424332 4:26501377-26501399 CACAGAAAGGAGATGGGGTGAGG - Intergenic
971475712 4:27069693-27069715 AAGGGGAAGGACAAGGCGTGGGG + Intergenic
972001999 4:34049386-34049408 CAGCGAAGGGAGATGGGGTGGGG + Intergenic
972377507 4:38486299-38486321 GAGAGAGAGGAAAAGGAGTGAGG + Intergenic
973850261 4:54954966-54954988 CAGAGAAAGGGGACTGAGTGGGG - Intergenic
974385869 4:61201582-61201604 CAGAGAAAGCAGCAGGAGGGTGG - Intronic
974798720 4:66785851-66785873 CAGAGAATGGAGATGGCAGGAGG + Intergenic
974904414 4:68037452-68037474 CAGAGAAGGGAGATGGGGTGGGG - Intergenic
975050544 4:69858753-69858775 GAGACTAAGGAGAAGGCTTGGGG - Intronic
975481007 4:74880314-74880336 CAAAGAATGGTGAAGGGGTGAGG + Intergenic
976467599 4:85388379-85388401 CAGAGAATGGAGAAGGTGCTTGG + Intergenic
976843286 4:89457325-89457347 CAGAGAAAGGAAAATAGGTGTGG + Intergenic
977745174 4:100538475-100538497 CAGAGAAATGAGCAGGAGGGTGG + Intronic
978624053 4:110664481-110664503 CAGAGAAAGGGGAAGCAGTGAGG - Intergenic
979251677 4:118572747-118572769 GAGAGAAATGAAAAGGCGTTTGG + Intergenic
979894687 4:126145287-126145309 CAGTGAAGGGAGATGGGGTGGGG + Intergenic
980285437 4:130773147-130773169 CAGGGAAGGGAGATGGGGTGGGG - Intergenic
980575172 4:134678038-134678060 CAGTGAAGGGAGATGGGGTGGGG + Intergenic
980575961 4:134683247-134683269 CAGGGAAGGGAGATGGGGTGGGG + Intergenic
980841231 4:138264155-138264177 CAGGGAAGGGAGAGGGGGTGAGG - Intergenic
980904409 4:138933420-138933442 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
981379523 4:144056906-144056928 CAGAGAGAGGAGAAGGAGTGAGG + Intergenic
981504144 4:145481891-145481913 CGGAGAAAGGAGAGGCCGAGCGG + Intronic
982490326 4:156021724-156021746 CAGCCAAAGGAGATGGGGTGAGG - Intergenic
983346071 4:166526307-166526329 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
983640664 4:169941597-169941619 CAGTGAAGGGAGATGGGGTGGGG - Intergenic
984099362 4:175466784-175466806 CAGTGAAGGGAGATGGGGTGGGG + Intergenic
984322731 4:178213219-178213241 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
984464664 4:180083088-180083110 CTGAGATAGGAGAATGGGTGTGG + Intergenic
985078473 4:186242058-186242080 CAGTGAAGGGAGATGGGGTGGGG + Intronic
985236415 4:187880284-187880306 GAGAGAGAGGAGAAGGGTTGGGG + Intergenic
985366642 4:189237810-189237832 CAGGGAAAGGAGACAGGGTGGGG - Intergenic
985436225 4:189931735-189931757 CAGTGAAGGGAGATGGGGTGGGG - Intergenic
985548791 5:523047-523069 CGGAGAAGGGAGGAGGCGGGAGG + Intronic
985691714 5:1316628-1316650 GAAAGACAGCAGAAGGCGTGAGG - Intergenic
986140542 5:5025963-5025985 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
986665750 5:10102532-10102554 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
986906123 5:12494393-12494415 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
987503954 5:18746306-18746328 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
987853022 5:23381496-23381518 CAGTGAAGGGAGATGGGGTGGGG - Intergenic
988643914 5:33072879-33072901 CAGAGATGGGAGATGGAGTGAGG + Intergenic
990497180 5:56360019-56360041 CAGAGAAATCAGAATGCGAGTGG + Intergenic
990723215 5:58722356-58722378 CAGAGAAGGCAGCAGGCATGGGG + Intronic
990830504 5:59951928-59951950 CAGAGAAAGGAGAAGTGAGGAGG - Intronic
991272185 5:64796950-64796972 GGGAGAGAGGAGAAGGGGTGGGG - Intronic
991371646 5:65925827-65925849 GAGAGAAAGGAGGAGGAATGGGG - Intergenic
992673079 5:79078964-79078986 CATAGAAAGCAGAATGCATGTGG - Intronic
994126393 5:96172074-96172096 CAGTGAAGGGAGATGGGGTGGGG + Intergenic
994776147 5:104037190-104037212 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
995013823 5:107288061-107288083 CAAAGGAAGGAGAAGGGTTGTGG - Intergenic
995296558 5:110531210-110531232 CAGTGAAGGGAGATGGGGTGGGG - Intronic
995714495 5:115068784-115068806 CAGAAAAAGGAGAAGAGGAGGGG - Intergenic
995898892 5:117046518-117046540 CAGCGAAGGGAGATGGGGTGGGG + Intergenic
996052206 5:118947547-118947569 CAGAGAGAAGAGAAGGGGAGAGG - Intronic
996357884 5:122616993-122617015 CAGTGAAGGGAGATGGGGTGGGG + Intergenic
996422901 5:123281424-123281446 GAGAGAAGGTAGAAGGCTTGAGG - Intergenic
996464565 5:123784602-123784624 GAGAGAAAGGAGGAGCCATGAGG - Intergenic
997051487 5:130386242-130386264 AACAGAAAGCAGAAGGCCTGAGG + Intergenic
997679175 5:135737190-135737212 CAGTGAAGGGAGATGGGGTGGGG + Intergenic
997694358 5:135849819-135849841 CAGGGAGAGGAGATGGCATGTGG + Intronic
997788996 5:136739501-136739523 CAGTGAAGGGAGATGGGGTGGGG - Intergenic
997815814 5:137016057-137016079 CAGAAGAAGGAGAAGGCCTAGGG + Intronic
998379373 5:141713117-141713139 CAGGGAAAAGAGAAGGCCTCTGG - Intergenic
998633273 5:143925061-143925083 CAGCGAAGGGAGATGGGGTGGGG + Intergenic
998693976 5:144616592-144616614 CAGTGAAGGGAGATGGGGTGGGG + Intergenic
1000095675 5:157968994-157969016 CAGTGAAGGGAGATGGGGTGGGG - Intergenic
1000607537 5:163340471-163340493 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
1000614348 5:163411210-163411232 CAGAGGACGGAGAAGCAGTGTGG + Intergenic
1002107323 5:176886630-176886652 CAAAGAAAGGAGGAGGAGAGAGG + Intronic
1002683374 5:180987586-180987608 GAGAGAAAAGACAAGGCGAGTGG + Intergenic
1003157839 6:3611420-3611442 CAGAGAAGGGAAGAGGTGTGGGG - Intergenic
1003429693 6:6027907-6027929 CAGCGAAGGGAGATGGGGTGGGG + Intergenic
1003492878 6:6639332-6639354 CTGAGAAGGGACAAGGCTTGTGG - Intronic
1003550453 6:7098325-7098347 CAGGGAAAGCAGGAGGGGTGAGG - Intergenic
1004390109 6:15202849-15202871 AAGAGAAATGAGAAGGGGTCAGG + Intergenic
1004609862 6:17229799-17229821 CAGAGAAAGGGCAACGGGTGAGG + Intergenic
1004873878 6:19935782-19935804 CAAATAAAGGAGAAAGAGTGTGG - Intergenic
1005631597 6:27713276-27713298 CAGAGAAAAGTGAAGACGGGTGG + Intergenic
1006082218 6:31574188-31574210 GAGAGAAAGAAGTAGGCATGAGG + Exonic
1006246426 6:32740981-32741003 CAGAGAAAGGGGAGGGAATGGGG + Intergenic
1006303684 6:33207166-33207188 CAGAGAAAGGAGAGGGGTGGGGG - Intergenic
1006496984 6:34430885-34430907 CCTAGAAAGGATAAGGAGTGAGG + Intergenic
1006912963 6:37576000-37576022 CAGACAAAGAAGAAGGAGTGTGG - Intergenic
1007084858 6:39136175-39136197 CAGCGAAGGGAGATGGGGTGGGG + Intergenic
1007114123 6:39331164-39331186 CAGAAAAAGAAGAAGGAGTTGGG - Exonic
1007788325 6:44294830-44294852 CACAGAAAGGAGAGGAGGTGGGG + Intronic
1008415699 6:51237453-51237475 CAGGGAAGGGAGAAGGTGGGAGG + Intergenic
1009359827 6:62797329-62797351 CAGAGAAGGGAGATGGGGTGGGG - Intergenic
1009591161 6:65672867-65672889 CAGTGAAGGGAGATGGGGTGTGG + Intronic
1010073280 6:71769666-71769688 CCAAGAAAGGGGAAGGCATGGGG - Intergenic
1010087110 6:71933602-71933624 CAGAGAGAAGAGATGGTGTGAGG + Intronic
1010205717 6:73321041-73321063 TACAGAATGGAGAAGGGGTGGGG + Intergenic
1010498255 6:76562575-76562597 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
1010613961 6:77990619-77990641 AAGAGAGAGGAGAAGGAGAGGGG - Intergenic
1010869681 6:81021991-81022013 AAGAGAAAGGAGAAGGGGTAGGG - Intergenic
1011805056 6:91062214-91062236 CAGAGGAAGGGGCAGGGGTGGGG + Intergenic
1011829301 6:91351910-91351932 CACTGAAAGGAGAAGAAGTGAGG - Intergenic
1012013922 6:93830213-93830235 CAGTGAAGGGAGATGGGGTGGGG + Intergenic
1012054784 6:94392724-94392746 CAGAGAGAGGGGAAGGAGTGTGG - Intergenic
1012999195 6:106005365-106005387 CAGAGGAAGGCCAAGGCCTGTGG - Intergenic
1013174267 6:107663920-107663942 CAGAGAAGGGAAGAGGAGTGAGG + Intergenic
1013700497 6:112763564-112763586 CAGAGAATGCAGAAGACCTGTGG - Intergenic
1014611801 6:123557132-123557154 CAGTGAAGGGAGATGGGGTGCGG - Intronic
1015164878 6:130192588-130192610 CAGCGAAGGGAGATGGGGTGGGG - Intronic
1016024952 6:139277600-139277622 CAGAGACAGAAAAAGGCTTGTGG - Intronic
1016536075 6:145108558-145108580 CAGTGAAGGGAGATGGGGTGGGG + Intergenic
1017525025 6:155234879-155234901 CAGAGGCAGCAGGAGGCGTGAGG + Intronic
1017648740 6:156562460-156562482 CAGAGGAAGGAGAGGCTGTGAGG + Intergenic
1017804198 6:157929209-157929231 CAAACAAAGGAGAAGGAGGGAGG - Intronic
1018078114 6:160234199-160234221 CAGTGAAAGGAGATAGGGTGGGG - Intronic
1018182065 6:161232733-161232755 GAGAGGAGGGAGATGGCGTGGGG - Intronic
1018268968 6:162055582-162055604 CACAGAAAGGAGGAGGAGGGAGG + Intronic
1018582732 6:165321468-165321490 CAGAGAAAAGAGAAGGCAACTGG + Intergenic
1019253069 7:30838-30860 CAGAGAAGGGAGAAACCCTGAGG - Intergenic
1019636389 7:2078311-2078333 AAGAGGAAGGAGAAGGCCAGAGG - Intronic
1019745037 7:2695096-2695118 CTGAGCAAGGAGGAGCCGTGAGG - Intronic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1020015554 7:4829365-4829387 CAGTGAAAGTGGAAGGCGTTCGG + Intronic
1020350058 7:7209832-7209854 CAGCGAAGGGAGATGGGGTGGGG + Intronic
1020632511 7:10656617-10656639 CAGAGAACTAAGAAGGCGGGTGG + Intergenic
1020668097 7:11072869-11072891 CAGAGAAAAGAGGAGGTGTCAGG + Intronic
1020950614 7:14671270-14671292 CAGAGAAAGGACCAGGAGTGAGG + Intronic
1022045628 7:26620167-26620189 CACTGAAAGGAGAATGAGTGAGG - Intergenic
1022099953 7:27163516-27163538 GAGAGAAGGGAGAAGGCGGAAGG + Exonic
1022572282 7:31466961-31466983 CAGCGAAGGGAGATGGGGTGGGG + Intergenic
1022709577 7:32838150-32838172 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
1023155582 7:37248420-37248442 CAGAGAAAGCAAAAGGAGTGAGG + Intronic
1023308498 7:38856601-38856623 CAGAGAAAAGAGAAAGGGTGGGG + Intronic
1023713737 7:43022011-43022033 GAGAGCAAAGAAAAGGCGTGAGG - Intergenic
1024919835 7:54545162-54545184 CCGAGAAGGGAGAGGGGGTGGGG - Intronic
1025851923 7:65251149-65251171 CCGGGAAAGGAGAAAGCGTAGGG - Intergenic
1026155339 7:67821147-67821169 CAGAGGCAGGAGATGGCTTGAGG - Intergenic
1026514946 7:71060795-71060817 CAAAGAAAGGAAAATGCCTGTGG + Intergenic
1026582839 7:71632423-71632445 CAAAGAAAGGAGAAGGCAGTAGG + Intronic
1026816987 7:73521476-73521498 GAGAGGGAGGAGGAGGCGTGGGG - Intronic
1027354942 7:77345758-77345780 CAGCGAAGGGAGATGGGGTGGGG - Intronic
1027851009 7:83451970-83451992 CAGAAGAAGGAGAACGAGTGTGG - Intronic
1028267392 7:88742989-88743011 AAGAGAAAGGAGAAGACACGCGG - Intergenic
1029026582 7:97423269-97423291 AAGAGAGAGGAGTAGGGGTGAGG - Intergenic
1029884951 7:103858958-103858980 CAGAGAAAGAAGAAGACTGGAGG + Intronic
1030751834 7:113238941-113238963 CAGCGAAGGGAGATGGGGTGGGG + Intergenic
1031421938 7:121563749-121563771 CAGTGAAGGGAGATGGGGTGGGG + Intergenic
1031422774 7:121569369-121569391 CAGCGAAGGGAGATGGGGTGGGG + Intergenic
1031750524 7:125566774-125566796 CAGAGAAAAGTGAAGACATGAGG + Intergenic
1031973554 7:128080185-128080207 CAGAGAATGGATCACGCGTGGGG - Intronic
1032398263 7:131606274-131606296 CAGAGAAGGGAGAAGAGGTTAGG - Intergenic
1032479757 7:132236854-132236876 GAGAGAAAGGAGAAGGCTGGGGG - Intronic
1032601378 7:133299863-133299885 CAAAGAGAGGAGAAGGACTGAGG - Intronic
1032855569 7:135830761-135830783 CAGAGAAAGGAGAAAGCAGAAGG + Intergenic
1033152153 7:138924882-138924904 CAGAGAAAGGAAAGGGGTTGGGG + Intronic
1033362518 7:140647850-140647872 CAGAGTCAGGAGAAGGAGTGAGG + Intronic
1033464443 7:141578178-141578200 CAGCGAAGGGAGATGGGGTGGGG + Intronic
1034054982 7:148024829-148024851 CAAAGAAAGGAGAAGGCAGGGGG - Intronic
1034546071 7:151790193-151790215 CAGAGGAAGGAAAGGGCTTGGGG - Intronic
1035060385 7:156064935-156064957 CACAGAAAGGGGAGGGCGAGGGG - Intergenic
1036446948 8:8829710-8829732 TTGAGAAAGGAGATTGCGTGGGG + Intronic
1037300247 8:17443993-17444015 GAGGGAAAGGAGGAGGAGTGAGG - Intergenic
1037616116 8:20520300-20520322 CAGAGAGAGGGGAAGGAGAGTGG - Intergenic
1037835218 8:22211567-22211589 CAGAGAAAAGAGATGGGGTAAGG - Intronic
1037928462 8:22863609-22863631 CAGAGCAGTGAGAAGGGGTGGGG - Intronic
1038020747 8:23550337-23550359 CAGAGAAACGTGAAGGAGGGCGG - Intronic
1039278976 8:35961633-35961655 CAGAAAAAGAAGAAGCCATGAGG - Intergenic
1039889172 8:41672712-41672734 CAGTGACCAGAGAAGGCGTGAGG + Exonic
1040781463 8:51114774-51114796 GAGAGAAGGGAGAAGGAGAGAGG - Intergenic
1041309733 8:56503162-56503184 CAGGGAAAGGAGATGGGGTCTGG + Intergenic
1041439086 8:57874586-57874608 CAGCGAAGGGAGATGGGGTGGGG + Intergenic
1041803589 8:61825619-61825641 CAGAGAAAGGACAAGGCATGGGG - Intergenic
1042719517 8:71812276-71812298 GAGAGAAAGGAGAAGGCTGAAGG - Intergenic
1042849530 8:73202901-73202923 CAGACAAAGTAAACGGCGTGGGG - Intergenic
1043037537 8:75217175-75217197 CAGCGAAGGGAGATGGGGTGGGG + Intergenic
1043342978 8:79263948-79263970 CTGAGGAAGGAGAACGCGGGAGG + Intergenic
1043448100 8:80339299-80339321 CAGAGAAAGGAAAAGATCTGGGG + Intergenic
1043718234 8:83510623-83510645 CAGCGAAGGGAGATGGGGTGGGG + Intergenic
1045130806 8:99149927-99149949 CACAGACAGGAGAAGGGGTATGG - Intronic
1045341006 8:101254474-101254496 CACAGAAAGGTGAAGGGCTGGGG - Intergenic
1045361140 8:101434265-101434287 CAGGGAAAGGAAAAGGCTTTGGG + Intergenic
1045701292 8:104869873-104869895 CAGAGAAAGGAGCAGGAGCCAGG + Intronic
1046412944 8:113872416-113872438 AAAAGAAAAGAGAAGGAGTGGGG - Intergenic
1047587127 8:126284534-126284556 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
1048585780 8:135772683-135772705 CAGCGAAGGGAGATGGGGTGGGG + Intergenic
1048668113 8:136687200-136687222 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
1048728708 8:137413585-137413607 CAGCGAAGGGAGATGGGGTGGGG + Intergenic
1048989699 8:139754091-139754113 CAGGGAAAGGTGAAGCCATGTGG + Intronic
1049292493 8:141812001-141812023 AAGAGAAAGGAGATGGCAGGAGG + Intergenic
1049374018 8:142280591-142280613 CAGGGAAGGGAGCAGTCGTGGGG - Intronic
1049502523 8:142974948-142974970 CAGAGAATGGAAAAAGCATGGGG + Intergenic
1049530766 8:143153736-143153758 CAGATAAAGGAGAAGCCATTTGG - Intergenic
1050020432 9:1278972-1278994 CAGAGAAAAGAGAAAGCTTTGGG - Intergenic
1050256999 9:3804416-3804438 GAGAGAAAGGAGAAGTTGTTTGG - Intergenic
1051350302 9:16192474-16192496 AAGAGATAGGAGAAGGAGGGAGG - Intergenic
1051952919 9:22658627-22658649 CAGGGAAGGGAGATGGGGTGGGG + Intergenic
1052282882 9:26753141-26753163 CAGAGAATGGTGAAGGGGAGTGG - Intergenic
1052560166 9:30075328-30075350 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
1052610696 9:30769774-30769796 CACAGAAAGAAGAAAGAGTGGGG + Intergenic
1053033488 9:34803476-34803498 CAGAGAAAAGCAAAGGGGTGAGG + Intergenic
1053263860 9:36696078-36696100 CAGGGACAGGAGAAGGGGTGAGG - Intergenic
1053303022 9:36965059-36965081 TGGAGCAAGGAGAAGGGGTGTGG - Intronic
1053361896 9:37493979-37494001 CAGAGGAGGGAGAAGGCCTCAGG + Intronic
1054807776 9:69410007-69410029 CAGCGAAAGGAGATGGGGTGGGG + Intergenic
1054863469 9:69976208-69976230 CAGAGAAGTGAGGAGGGGTGAGG + Intergenic
1055051568 9:71986799-71986821 CACTGACAGGAGAAGGGGTGAGG - Intergenic
1055174350 9:73299220-73299242 CAGTGAAGGGAGATGGGGTGGGG + Intergenic
1056391614 9:86146391-86146413 CAGCAAAAGGAGATGGGGTGGGG - Intergenic
1057184018 9:93046330-93046352 AAGAAAAAGAAAAAGGCGTGGGG + Intergenic
1057443449 9:95098016-95098038 CAGAGGAAGAAAAAGGCGAGGGG + Intergenic
1057472329 9:95368840-95368862 CAGAGTTAGGAGGAGGTGTGAGG + Intergenic
1057489986 9:95513029-95513051 CAGAGAAGGGAGGAGATGTGAGG - Intronic
1058848921 9:108991187-108991209 CAGAGAACTGGGAAGGGGTGAGG + Intronic
1058944258 9:109841765-109841787 GAGAGAAAGGAGAGGGTGGGGGG + Intronic
1059348408 9:113647819-113647841 CAGAGAAAGGAGAAAAATTGGGG + Intergenic
1059542505 9:115144330-115144352 AAGGGAAAGGAGAAGGGGAGGGG - Intronic
1059549743 9:115217015-115217037 CACAGAAAGGAGAAGTTGAGAGG + Intronic
1060175016 9:121491348-121491370 CAGAGAAAGGAGCAAGCCTAGGG - Intergenic
1060294076 9:122331464-122331486 CAGAACTAGGAGTAGGCGTGAGG - Intergenic
1060673322 9:125489962-125489984 AAGGGAAAGGAGAAGGCACGTGG - Intronic
1060997781 9:127884899-127884921 CAGTGAATGCAGAAGGGGTGAGG - Intergenic
1061232187 9:129321389-129321411 CAGGGAAAGGCGAAGGAATGTGG - Intergenic
1061865185 9:133488377-133488399 CAGAGAAAGCTGGAGCCGTGTGG - Intergenic
1061879111 9:133559830-133559852 GAGTGAAGGGAGAAGGCATGGGG - Intronic
1061890124 9:133614886-133614908 CAGAGAAAGGAGAATGGCAGGGG + Intergenic
1061945888 9:133908050-133908072 CAGAGAAGGTAGGGGGCGTGGGG - Intronic
1062597618 9:137306256-137306278 CAGAGTAAGGAGCAGGCTTCGGG - Intergenic
1062747300 9:138221528-138221550 CAGAGAAGGGAGAAACCCTGAGG + Intergenic
1185661134 X:1729891-1729913 CAGAGAGAGAAGACAGCGTGGGG - Intergenic
1185884893 X:3773667-3773689 CAGAGAAATGAGAAGGCAGGAGG - Intergenic
1186102601 X:6172996-6173018 CAGAGAGTGGAGTAGGGGTGAGG - Intronic
1186314642 X:8356167-8356189 CAGCGAAGGGAGATGGGGTGGGG + Intergenic
1186326688 X:8485504-8485526 CACAGAACGGAGCAGGAGTGTGG + Intergenic
1186661438 X:11671476-11671498 GAGAGAAAGGAGAAGGCAAATGG + Intergenic
1187298251 X:18023658-18023680 CGGAGAAGGGAGAAGGGGTGTGG - Intergenic
1187824210 X:23318445-23318467 CAGAGAAGGGAGAAGGAGGTTGG - Intergenic
1187882913 X:23862944-23862966 CAGGGAAGGGAGAAGGAGGGAGG + Intronic
1188510613 X:30932151-30932173 CAGAGAAAGGGGAAGGGCTGGGG + Intronic
1189110638 X:38286203-38286225 GAGAGGAAGGAGAAGGGGAGGGG - Exonic
1189446192 X:41084532-41084554 CAGCGGAAGGAGGGGGCGTGGGG - Intergenic
1190735768 X:53255256-53255278 ATGAGAAAGGAGAAGGAGAGAGG + Intronic
1190853335 X:54267884-54267906 CAGTGAAAAGAGCAGGCTTGGGG + Intronic
1192195703 X:69026493-69026515 CAGAGGAAGGAGAATACGAGTGG + Intergenic
1192535278 X:71922219-71922241 CAGAGAAAGGAAGAGGACTGGGG + Intergenic
1192542968 X:71990634-71990656 CACAGAAAGTAGTAGGCCTGAGG - Intergenic
1192705804 X:73528000-73528022 CAGGGAAGGGAGATGGGGTGGGG - Intergenic
1193018605 X:76764570-76764592 CAGAGAATGGAAAAGGTGAGTGG + Intergenic
1193718361 X:84958417-84958439 CAGCGAAGGGAGATGGGGTGGGG + Intergenic
1193886393 X:86987364-86987386 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
1193976576 X:88127587-88127609 GAGAGAAAAGAAAAGGCATGTGG + Intergenic
1194876396 X:99193834-99193856 CAGAGCAAGAAGAAGGCTTGGGG + Intergenic
1195234081 X:102879720-102879742 CAGAGAAGGGAGAAGAAGAGAGG - Intergenic
1195666634 X:107437342-107437364 CAGAGAAAGCACAAGGCAGGAGG - Intergenic
1195696878 X:107674007-107674029 CAGAGGAAGGGGAAGGGGCGGGG + Intergenic
1195868830 X:109464284-109464306 TAGAGAAAGAAAAAGGAGTGAGG - Intronic
1196484084 X:116183893-116183915 CACAGAAAGGAGAAGGAGAAAGG + Intergenic
1197226480 X:123960798-123960820 CTGAGAAAGAAGGAGGAGTGGGG + Exonic
1197355141 X:125430325-125430347 CAGAGACAGGAGAAGGAGAAGGG - Intergenic
1198598934 X:138264459-138264481 CAGCGAAGGGAGATGGGGTGGGG + Intergenic
1198599723 X:138269734-138269756 CAGCGAAGGGAGATGGGGTGGGG + Intergenic
1198640958 X:138756252-138756274 CAGAGAAAAGAGAAGGCAGCTGG + Intronic
1198984002 X:142428651-142428673 CAGTGAAGGGAGATGGGGTGTGG + Intergenic
1198994975 X:142564009-142564031 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
1199378331 X:147138317-147138339 CAGTGAAGGGAGATGGGGTGGGG - Intergenic
1199803941 X:151279351-151279373 CAGAGAAAGGCAAAGGAATGGGG - Intergenic
1199880876 X:151973741-151973763 CAGGGCGAGGAGAAGGTGTGAGG + Intronic
1200743870 Y:6885102-6885124 CAGAGAAAGGAGAATGCTTACGG + Intergenic
1200753406 Y:6967773-6967795 GAGAGAGAGCAGAAGGAGTGAGG - Intronic
1201234517 Y:11896411-11896433 CAGTGAAGGGAGATGGGGTGGGG + Intergenic
1201473782 Y:14359738-14359760 CAGTGAAGGGAGATGGGGTGGGG + Intergenic
1201597859 Y:15692316-15692338 CAGTGAAGGGAGATGGGGTGGGG + Intergenic
1202075928 Y:21037934-21037956 CAGTGAAGGGAGATGGGGTGGGG - Intergenic