ID: 932302449

View in Genome Browser
Species Human (GRCh38)
Location 2:70676770-70676792
Sequence GAGCAGAGGCTGCCCCTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 5, 3: 28, 4: 271}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932302449_932302457 23 Left 932302449 2:70676770-70676792 CCAGTCAGGGGCAGCCTCTGCTC 0: 1
1: 0
2: 5
3: 28
4: 271
Right 932302457 2:70676816-70676838 CAATGACGCTCGCCAGGAGCTGG 0: 1
1: 0
2: 0
3: 7
4: 105
932302449_932302452 -10 Left 932302449 2:70676770-70676792 CCAGTCAGGGGCAGCCTCTGCTC 0: 1
1: 0
2: 5
3: 28
4: 271
Right 932302452 2:70676783-70676805 GCCTCTGCTCTACCGGGCTTCGG 0: 1
1: 0
2: 0
3: 5
4: 106
932302449_932302456 17 Left 932302449 2:70676770-70676792 CCAGTCAGGGGCAGCCTCTGCTC 0: 1
1: 0
2: 5
3: 28
4: 271
Right 932302456 2:70676810-70676832 TCTCGGCAATGACGCTCGCCAGG 0: 1
1: 0
2: 0
3: 2
4: 30
932302449_932302454 0 Left 932302449 2:70676770-70676792 CCAGTCAGGGGCAGCCTCTGCTC 0: 1
1: 0
2: 5
3: 28
4: 271
Right 932302454 2:70676793-70676815 TACCGGGCTTCGGCTCTTCTCGG 0: 1
1: 0
2: 0
3: 10
4: 21
932302449_932302458 24 Left 932302449 2:70676770-70676792 CCAGTCAGGGGCAGCCTCTGCTC 0: 1
1: 0
2: 5
3: 28
4: 271
Right 932302458 2:70676817-70676839 AATGACGCTCGCCAGGAGCTGGG 0: 1
1: 0
2: 1
3: 16
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932302449 Original CRISPR GAGCAGAGGCTGCCCCTGAC TGG (reversed) Intronic
900590363 1:3456739-3456761 AATCAGAGCCTGCCTCTGACAGG - Intronic
900653997 1:3746102-3746124 GAGCTGAGGCTGAGGCTGACGGG + Intergenic
901414665 1:9108401-9108423 GGGCTGAGGCTGACCCTTACGGG - Intronic
901931066 1:12596264-12596286 GAGGAGAGGCTGCCCCCGGAGGG - Intronic
903212168 1:21824418-21824440 GAGCAGAGGCTGCCGAGGCCAGG + Exonic
904369624 1:30040198-30040220 AAGCAGAGGGAGGCCCTGACAGG + Intergenic
904370914 1:30046873-30046895 GAGCAGAGCCTGCCAGTCACGGG + Intergenic
904875645 1:33652544-33652566 GAGGAGAGGCTGAGGCTGACAGG + Intronic
905012788 1:34758605-34758627 GAAGAGAGGATGCCCCTCACAGG - Intronic
905322617 1:37128724-37128746 GTGCAGAGGCTGCAGCTGAGGGG - Intergenic
905803510 1:40860846-40860868 GGGCAGAGGCTGCCACTGGGTGG - Intergenic
905923514 1:41734119-41734141 GAGCAGAGGCTGCACCCACCAGG + Intronic
906346574 1:45019316-45019338 GAGCTCAGGCTCCCCCTGACAGG - Exonic
906507845 1:46393453-46393475 AACCAGAGACTGCCCCTGAAGGG + Intergenic
907347954 1:53799702-53799724 GAGCACAGGCTTCCTCTGAAGGG - Intronic
907401214 1:54226104-54226126 TGGGAGAGGCTGCCACTGACAGG - Intronic
912227411 1:107750557-107750579 GAGCTGATGCTGCCCCCTACTGG + Intronic
912455131 1:109792087-109792109 GAGGCGAGGCTGGCCCTAACAGG - Intergenic
913257531 1:116967255-116967277 CGCCAAAGGCTGCCCCTGACAGG - Exonic
915340596 1:155174760-155174782 GAGAAGGGGGTGCCGCTGACCGG + Intronic
915474845 1:156147363-156147385 CAGCAGAGTCTGCACCGGACAGG - Intronic
915935358 1:160087448-160087470 GAGCTGAGATTCCCCCTGACCGG + Intronic
917736022 1:177921089-177921111 GAGCAGAGGGTTCCCCCAACAGG - Intergenic
920052532 1:203172402-203172424 GAGCAGGTGCTGCACCTGTCAGG + Intronic
920182134 1:204138490-204138512 GAGCAGAGGCTGGCACTGGCAGG - Intronic
922423708 1:225475574-225475596 GAGCAGAGGGCGCCCCGGGCAGG - Intergenic
922801970 1:228368572-228368594 GAGCAGAGGCTGTCCCCAAATGG + Intronic
923403953 1:233642429-233642451 GAGCAGATACTGGCCCTGAGGGG + Intronic
923449534 1:234103657-234103679 AAGCAGAGTCTGCCCCTGACAGG - Intronic
1063032315 10:2247832-2247854 GAGCTGAGGTTGCCCCTGGGGGG - Intergenic
1067069971 10:43124164-43124186 CAGCCCAGGCTGCCCCTGCCTGG - Intronic
1067139876 10:43648380-43648402 GAGGAGAGGCAGCCCCTGCGGGG - Intronic
1067539397 10:47140820-47140842 GAGCAGAGGGAGCCCCAGCCTGG + Intergenic
1069646405 10:70001624-70001646 GACCAGAGGCTACCACTGCCCGG + Intergenic
1069667123 10:70170320-70170342 GAGCGGAGGCTGGCCCTGGCGGG - Intronic
1069985328 10:72279054-72279076 GGGCAGAGGACGCCCATGACTGG + Intergenic
1070212893 10:74345364-74345386 AAGCAGAGGTTGCCACTCACTGG + Intronic
1070552480 10:77501641-77501663 GAGCAGAGGCTGACCCGATCTGG + Intronic
1070617679 10:77981578-77981600 GAGCAGAAGCAGCCCCTTCCGGG + Intronic
1070724914 10:78781286-78781308 GAGCACAGGCAGCCGCTGAGAGG - Intergenic
1072753604 10:98002026-98002048 GAGCTGAGGCTGACCCTCCCTGG - Intronic
1073070195 10:100788433-100788455 GACCAGAGGCTGCCACTGCCTGG + Intronic
1073107992 10:101043524-101043546 GAGCGGAGGCTGCCTTTGTCTGG - Intergenic
1073486164 10:103820416-103820438 GACCAGATGCAGCCCCTGGCAGG - Intronic
1074986910 10:118667072-118667094 GAGAAGAGGGTGCCCTGGACAGG + Intergenic
1075776605 10:124993157-124993179 GAGCTGAGGCTGCCCTTGGCAGG + Intronic
1076007197 10:126957020-126957042 GGGCACAGGCTGCACCCGACGGG + Intronic
1076554216 10:131311558-131311580 GAGGAGAGGCTGCCGCCGCCGGG + Exonic
1076688659 10:132209566-132209588 GGACGGAGGCTGCCCCTGGCAGG + Intronic
1076826794 10:132973412-132973434 GAGCTGAGGCTGCCCTGGAGGGG + Intergenic
1077116524 11:887627-887649 GAGTAGAAGCTGCGGCTGACAGG - Intronic
1078088713 11:8250726-8250748 CAGCAGAGGCTGCATCCGACTGG - Intronic
1078174944 11:8963734-8963756 GAGCTGAGTCGGCCCTTGACAGG + Intronic
1078666945 11:13333645-13333667 GCGCAGTGGCTGCCCATGACAGG + Intronic
1078927121 11:15885072-15885094 GAGCAGGGGCTGCTTCTTACAGG - Intergenic
1083148349 11:60774750-60774772 GAGCAAAGGCTGCCTCGGGCAGG + Intronic
1083267302 11:61552643-61552665 GGGAAGGGGCTGCCCCTGGCAGG - Intronic
1083295390 11:61712557-61712579 GAGCGGAGCCTGCCCAGGACTGG - Intronic
1084374192 11:68764674-68764696 GAGGAGAGGAGGCCCCTGAAAGG + Intronic
1084424680 11:69078028-69078050 GGGCAGACGCTGCCACTGTCAGG - Intronic
1084429020 11:69101175-69101197 GAGCAGAGGGGGCTCCTGGCAGG + Intergenic
1084456193 11:69269428-69269450 GACCACATGCTGCCTCTGACTGG - Intergenic
1084519324 11:69654073-69654095 GAGCACAGGATGACCCTGCCAGG - Exonic
1084532678 11:69738046-69738068 GAACAGAGGCAGCCGGTGACAGG + Intergenic
1084940083 11:72607766-72607788 GAGCAGAGGCTGCCCTTGGCCGG + Intronic
1085170456 11:74445306-74445328 GAGCAGAGACTGCCCATTACAGG - Intergenic
1085410413 11:76287449-76287471 GGGCGGAGGCTGCTCCTGGCGGG + Intergenic
1089625872 11:119750521-119750543 GAGCAGAGGCTGCATCTGGATGG + Intergenic
1091205423 11:133817738-133817760 GAGCACACGCTGTCCCTGGCTGG - Intergenic
1093673642 12:21907377-21907399 GTGAAGATGCTGCCACTGACAGG - Intronic
1098241551 12:68472520-68472542 GGGCTGAGGCTGCCCCTGCTTGG - Intergenic
1102412272 12:112730361-112730383 CAGCTGAGGCTACCCCTGATGGG - Intronic
1102713865 12:114952896-114952918 GAGCAGACACGGCCCCAGACTGG - Intergenic
1104617287 12:130281357-130281379 GCGCAGCGGCTCCCCCTGCCGGG - Intergenic
1104622251 12:130325410-130325432 GACCTGAGGCTGGCCCTCACTGG + Intergenic
1108493641 13:51004448-51004470 GAACATCGGCTGCCCCTGGCAGG + Intergenic
1110567340 13:76969606-76969628 AAGCAGAGGCTGCCCAGAACAGG - Intergenic
1113175128 13:107554962-107554984 CAGCAGAGGCCTCCCCGGACAGG - Intronic
1113346372 13:109482460-109482482 GAGCAGAGGCGGCCCCAGAGGGG + Intergenic
1113667879 13:112153575-112153597 GAGCAGTGGCAGGCCCTGTCCGG + Intergenic
1113748979 13:112765405-112765427 GAGCAGAGGCGGGGCCTGCCCGG - Intronic
1119163277 14:72471068-72471090 GAGCACAGGCTGACCCAGATGGG + Intronic
1119386642 14:74261483-74261505 GGGCAGAGGCTGGGCCTGCCTGG - Exonic
1120747870 14:88168175-88168197 CAGCAGAGGCTTTCCCTGATGGG + Intergenic
1121273073 14:92650878-92650900 GAGCCTTGGCTTCCCCTGACTGG + Intronic
1121339411 14:93096246-93096268 GAGCTGTGGCTGCTGCTGACAGG - Intronic
1121611877 14:95286851-95286873 GAGCAGAGGCTGGCACACACAGG - Intronic
1121678233 14:95771630-95771652 GAGGAGAAGCTGCCCCTCCCTGG - Intergenic
1121940403 14:98064768-98064790 GAGCAGAGGCTGCCCCAAGAGGG - Intergenic
1122242215 14:100376390-100376412 GGGCAGAGGCCGCCACTGATTGG + Exonic
1122414094 14:101540584-101540606 GAGCAGAGGCTGCCGGGGGCAGG + Intergenic
1122445814 14:101767793-101767815 GAGCTGAGGCTGCGGCTGCCAGG - Intronic
1122541471 14:102499952-102499974 CAGCAGAGGCAGCCCCAGGCCGG + Exonic
1122576992 14:102749040-102749062 GAGAGGAGGCTGCGCCTGAGAGG + Intergenic
1122828492 14:104383766-104383788 GAGCAGATGCTGCCCTTGGAAGG - Intergenic
1124259840 15:28178842-28178864 GAGCAAAGGCCGCCCCGCACAGG + Intronic
1124377772 15:29139646-29139668 GAGCAGAGGCTGCCACACACTGG + Intronic
1124662538 15:31562183-31562205 GGGGAGAGGCTGCCCCTCCCAGG + Intronic
1125537785 15:40452572-40452594 AAGCAGAGGCTGCCTGGGACAGG - Intronic
1125676416 15:41504671-41504693 GAGGGGAGGCTACACCTGACGGG - Intronic
1126552342 15:49946778-49946800 AAGCAGGGGCTGCCCCAGACTGG + Intronic
1127267698 15:57375012-57375034 GAGCAGAGGCTGCCTGGGGCAGG - Intergenic
1128113674 15:65092392-65092414 GAGCAGAAGGGGCCCCAGACTGG + Intergenic
1128479475 15:68024856-68024878 GAGTTGAGGCTGCCCATGGCTGG + Intergenic
1128643548 15:69358478-69358500 CACCAGAGGCTGCCCCTGGACGG - Intronic
1129153364 15:73702894-73702916 GGGCAGGGTGTGCCCCTGACTGG + Exonic
1129153677 15:73704298-73704320 GGGCAGGGTGTGCCCCTGACTGG + Exonic
1129660751 15:77551518-77551540 AGGCAGGGGCTGCCCCTGCCTGG + Intergenic
1129660883 15:77552287-77552309 GAGCAGGGTGTGGCCCTGACAGG - Intergenic
1131600714 15:93846214-93846236 GATCAGAGGCTCCCACTGAGAGG + Intergenic
1132546915 16:537465-537487 GAGCTGAGGTTGGCCCTGGCAGG + Intronic
1133065509 16:3203909-3203931 GGACAGAGGCTGGTCCTGACTGG - Intergenic
1133914959 16:10101130-10101152 GAGAAGAGGTTGCCCATGAAAGG - Intronic
1134225395 16:12386012-12386034 CAGCTGAGGCCGCCCCTGCCTGG - Intronic
1136479149 16:30530867-30530889 GGGCAGGGGCTGCCCGTGGCTGG + Intronic
1142412053 16:89921868-89921890 CAGCAGAGGCGGGCCCTGCCAGG - Intronic
1142574075 17:894695-894717 CTGCAGAGGCTGCCCCCGGCAGG - Intronic
1142640140 17:1280769-1280791 CAGCAGAGGTTGCACCGGACGGG + Intronic
1142695881 17:1633385-1633407 TAGAAGGGGCTGCCCCTGGCCGG + Intergenic
1145251369 17:21298585-21298607 CAGCAGGGGCTGCCCAGGACAGG - Intronic
1145784428 17:27584861-27584883 GAGCAGAGGTAGCCCCTGAAAGG - Intronic
1145974842 17:28978012-28978034 TAGGAGAGGGTCCCCCTGACAGG + Intronic
1147156935 17:38548727-38548749 GGGCAGAGCCTGGCCTTGACAGG - Intronic
1147669649 17:42169696-42169718 GAGGGGTGGCCGCCCCTGACAGG - Intronic
1148053788 17:44781714-44781736 GAGTGGAGGCTGCCTCTGCCTGG + Exonic
1148246111 17:46031976-46031998 CAGCAGATGCTGCCCCTTCCTGG + Intronic
1149639539 17:58193847-58193869 CAGGAGGGGCTGCCCCTGCCTGG + Intronic
1151311213 17:73293465-73293487 GACCAGAGGCTGCCCCTGGAAGG - Intronic
1151379093 17:73712569-73712591 GTGCACAGGCTGCCCATCACGGG - Intergenic
1152015815 17:77749590-77749612 CAGCAGAGGCAGCTCCTGAGGGG - Intergenic
1152133300 17:78490223-78490245 AGGCGGAGGCTGCTCCTGACGGG - Intronic
1152750875 17:82061934-82061956 GAGCAGAAGGGGCCCCTGTCGGG - Exonic
1154042966 18:10876862-10876884 GAGCAGGGGCAGCCCCTGAGAGG - Intronic
1154393913 18:13969805-13969827 GAGCAGTGGCAGACTCTGACAGG + Intergenic
1158505459 18:58043680-58043702 GAGGAGAGGCTGCCCCAGTGTGG - Intergenic
1160719810 19:592159-592181 GGGCAGTGGCACCCCCTGACCGG + Intronic
1160985488 19:1836771-1836793 GAGCAGGGGCTGGGCCTGCCGGG - Intronic
1161222882 19:3126124-3126146 GAGCAGAGACAGGACCTGACAGG + Intergenic
1161435120 19:4258469-4258491 GGGCAGAGGCAGCGCCTGCCGGG - Intronic
1162041809 19:7975300-7975322 GAGCTGAGGCTGGCACTGACTGG + Intronic
1162426923 19:10602575-10602597 CAGCAGAGGCGGCCCCTGACCGG - Intronic
1163557285 19:17999942-17999964 GAGCAGTGGCTGCCCCTCTGGGG + Exonic
1164796776 19:31040006-31040028 GAGCAGATGCTTCCCCAGCCAGG + Intergenic
1165893576 19:39128732-39128754 GGACAGAGGCTGCCCCTGGAAGG - Intronic
1166198261 19:41220353-41220375 GGGCAGGGGCTGGCCCTGCCAGG + Intronic
1167123623 19:47533965-47533987 CAGGAGAGGCAGCCCCTGTCTGG - Intronic
1168290946 19:55357260-55357282 GTGAAGAGGCTGCCTCTGGCTGG - Intronic
1168638872 19:58017438-58017460 GAGCAGGGGCTGCCTCAGGCAGG + Intergenic
925059492 2:880226-880248 GAGCCGAGCCTGCCCGGGACAGG - Intergenic
925069183 2:952549-952571 GAGCAGAGGCCACTCTTGACTGG - Intronic
926729458 2:16025337-16025359 GAGGAGATGGTGCCCCTCACGGG + Intergenic
927023657 2:19043316-19043338 GAGCAGAGAGAACCCCTGACTGG - Intergenic
927513467 2:23658638-23658660 TGGCAGCGGCGGCCCCTGACTGG - Intronic
928812967 2:35251835-35251857 GAGCAGGAGGTGCCCCTGAAGGG - Intergenic
928901391 2:36321996-36322018 AAGAAGATGCTGCACCTGACTGG + Intergenic
930036271 2:47087303-47087325 GAGCAGAGGCTGCTCCTGTTAGG + Intronic
931226148 2:60333847-60333869 GAGCTAAAGCTGCCCTTGACAGG - Intergenic
931851362 2:66254327-66254349 TAGCAGAGGCTGCCCTTGACTGG + Intergenic
932302449 2:70676770-70676792 GAGCAGAGGCTGCCCCTGACTGG - Intronic
932607125 2:73172778-73172800 GGCCAGAGGCTGCCCCTTAGAGG - Intergenic
932732550 2:74231477-74231499 GAAGACAGGCGGCCCCTGACTGG + Intronic
934526360 2:95054240-95054262 AAGGAGAAGCTGCCCCTGGCTGG - Intergenic
935230359 2:101090549-101090571 CAGCAGGACCTGCCCCTGACAGG + Intronic
938092827 2:128444504-128444526 GAGCAGATGGTGCCACTGCCAGG - Intergenic
939995367 2:148914871-148914893 GAGTAGAGGCTTCTGCTGACTGG + Intronic
940123384 2:150294041-150294063 CAGCAGAGGCTGGGCCTGATGGG - Intergenic
943396311 2:187339044-187339066 TAGCAGAGGCTACTCCAGACGGG + Intergenic
948071773 2:235133836-235133858 GGACAGAGGCTGCCCTTGGCAGG - Intergenic
948589160 2:239038491-239038513 GAACAGAGGCAGCCCCGGCCCGG - Intergenic
948629703 2:239294237-239294259 CAGAAGGGGCTGCCCCTGCCTGG - Intronic
948783095 2:240336998-240337020 GAGCAGAGGCTCCAGCAGACAGG + Intergenic
948830372 2:240595652-240595674 GAGCTGGGACTGGCCCTGACAGG - Intronic
949022827 2:241751197-241751219 GAGCAGAGGCTCCGGCTGCCAGG - Intronic
949049218 2:241888339-241888361 GAGCTGTGGCTGCCTCTGAGAGG - Intergenic
1170901993 20:20473071-20473093 GAGCAGACGCTGACCTTAACAGG + Intronic
1171171079 20:23015808-23015830 AAGCTGAGGCTGCCCATGGCAGG + Intergenic
1173005151 20:39134564-39134586 AAGCAGAGGGAGCCCCTGTCTGG + Intergenic
1173470694 20:43321176-43321198 TTGCAGGGGCTGCCCCAGACCGG + Intergenic
1174521468 20:51134079-51134101 GAGCAGAGCTTGCTCCTGGCTGG + Intergenic
1174768068 20:53272383-53272405 GGGCAGGGGCTGCATCTGACTGG + Intronic
1175426713 20:58872004-58872026 GAGGAGAGGATGCCCCAGCCTGG - Intronic
1175800430 20:61798218-61798240 GAGCTGAGGGTGCTCCTGGCAGG - Intronic
1180076775 21:45467162-45467184 GAGCAGGGTCTGCCCTTGAGTGG + Intronic
1180104931 21:45612332-45612354 GCGCCGAGGCTGCTCCTGACAGG - Intergenic
1180174258 21:46080113-46080135 GAGCAGGGGCTGCACCTCCCCGG - Intergenic
1180732277 22:17991093-17991115 GAGCAGAGGCTGGGCCAGCCAGG + Intronic
1180905349 22:19406753-19406775 GAGCAGAGGCTGCCCCAGGTGGG + Intronic
1181138548 22:20786695-20786717 GTGCAACGGCTGCCCCTGACAGG + Intronic
1181473885 22:23156985-23157007 GTGCAGAGGAAGCCCCTGTCCGG + Intronic
1181580218 22:23824095-23824117 GAGAAGAGGCTGGTCCTGCCAGG + Intronic
1183213302 22:36464087-36464109 GAGCAGTGCCTGCCCCTACCAGG - Intergenic
1183960745 22:41410518-41410540 GAGCACAGGATGTCCCTGGCAGG + Intergenic
1184086564 22:42269677-42269699 GAGGAGAGGCCGCCCCACACAGG + Intronic
1184231214 22:43159389-43159411 GAGTAGAGCGTGCCCCAGACAGG - Exonic
1184243498 22:43223601-43223623 TAGCAGAGGCTGCCCCAAAGAGG - Intronic
1184478999 22:44736387-44736409 GGGCAGGGGCTGCGCCTGCCTGG + Intronic
1184630474 22:45774290-45774312 GAGCAGGAGCTGCACCTGTCTGG + Intronic
1184965056 22:47965569-47965591 AAGCAGAGCCTGCCCTTGCCTGG - Intergenic
1184984644 22:48121463-48121485 GAGCAGAGGCTGCACCTGAATGG + Intergenic
1185137984 22:49084181-49084203 GAGAAGAGGCTGCCCCTGTGGGG - Intergenic
1185198894 22:49490333-49490355 CAGCAGAAGCTCCCGCTGACAGG - Intronic
953178608 3:40575532-40575554 GAACAGTGGCTGCCTCTGAGGGG - Intergenic
955227601 3:57073871-57073893 GGGCAGAGGCTGCTCCTGGCAGG - Exonic
955745445 3:62135861-62135883 GAGCAAAGACTGCCCCTGAAAGG + Intronic
959934581 3:112015587-112015609 GAGCAGAGGTTTACCCTGAGTGG + Intergenic
961340511 3:126213986-126214008 GAGGAGTGGCTGCCCCTGAGAGG - Intergenic
961473843 3:127134896-127134918 GAGCAGACGCTCCCCCCAACAGG - Intergenic
961643384 3:128379183-128379205 CAGGAGAGGCTGGCCCTGTCAGG - Intronic
962714388 3:138114666-138114688 GGGCCTAGGCTGCCCCTGCCTGG - Intronic
963130558 3:141854005-141854027 GAGCAGTGGCTGCACCTGCCAGG + Intergenic
964721238 3:159768912-159768934 GAGCAGGGGCTGCCCATGGAAGG - Intronic
964815258 3:160710592-160710614 GAGCAGATGCTCCCTCTGACTGG + Intergenic
966851692 3:184168773-184168795 GAGCAGAGGGTGTCCCAGGCAGG + Intronic
967805210 3:193709708-193709730 GAGCAGAGCTGGGCCCTGACTGG - Intergenic
967867558 3:194203072-194203094 GGGCAGAGGATGCCTCTGAGAGG + Intergenic
968884601 4:3320963-3320985 GAGCAGAGGAGGCCCCTGGAGGG + Intronic
969841485 4:9886163-9886185 GAGCAGAGACTGCTCCTGTCTGG + Intronic
971009780 4:22420993-22421015 GATCAGAGGCTGCCACTTTCTGG + Exonic
972671426 4:41216347-41216369 GAGCGGAGCCTGCCCCTCCCAGG + Intronic
974118689 4:57611867-57611889 GAGGAGTGGCTGCTCCTAACTGG - Intergenic
978529379 4:109698872-109698894 GAGCAGAGGGCTCCCCTTACAGG - Intronic
979361372 4:119769518-119769540 GAGCAAGGCCTGCTCCTGACTGG + Intergenic
983940856 4:173532875-173532897 GAGGCCAGGCTGGCCCTGACTGG + Intergenic
984836609 4:184028360-184028382 AAGCAGAGGCTCCCCCAGCCAGG - Intergenic
985390908 4:189490965-189490987 GAGCTGTGGCTGACCCTCACTGG + Intergenic
985768354 5:1793666-1793688 GAGAAGGGGCTGAGCCTGACTGG + Intergenic
985878520 5:2619362-2619384 TTGAAGAGGCTGCCCCTGCCAGG + Intergenic
985988709 5:3538190-3538212 TATCAGACGCTGCCACTGACAGG + Intergenic
986790265 5:11152842-11152864 GAGCAGAGGAAGCTCCTGGCCGG - Intronic
988300932 5:29425840-29425862 GAGCAGAGGTTGCCACAGAATGG + Intergenic
988489664 5:31695708-31695730 AAAAAGAGGCTGCCCCTGCCTGG - Intronic
989379390 5:40798328-40798350 GCGCAGACGCTCCCCCTGGCGGG + Exonic
990986998 5:61649811-61649833 GGGCAGAGGCTGGCCATGGCAGG + Intronic
991478536 5:67050436-67050458 GAGGACTGGCTGCCCCTGAGGGG - Intronic
996710791 5:126541621-126541643 CAGCAGAGGCGACACCTGACAGG + Intergenic
997667366 5:135642409-135642431 AGGCAGGGGCTGTCCCTGACAGG - Intergenic
997859822 5:137406181-137406203 GGTGAGAGGCTGCCCCTGTCTGG - Intronic
998193252 5:140043985-140044007 GAGCAGCCTCTGGCCCTGACAGG - Intergenic
999937728 5:156505580-156505602 GAGCAGCAGCCGCCCCTGCCTGG - Intronic
1000004020 5:157166414-157166436 GGGGAGAGGCTGACCCTGCCTGG + Intronic
1000129827 5:158285919-158285941 GGGCAGAGTCTGCCTCTGACAGG + Intergenic
1001987419 5:176086475-176086497 GAGCAGGGGCTGCCACTCAGAGG - Intronic
1002105166 5:176876447-176876469 GAGCAGGGACTCCCCCAGACAGG - Intronic
1003364360 6:5458220-5458242 CAGCAAAGCCTGCCCATGACTGG + Intronic
1003375351 6:5571949-5571971 GAGCTGAGGCTGCAGGTGACAGG - Intronic
1005829156 6:29656924-29656946 GAGCAGAGGCTGCCTGGTACAGG - Intergenic
1006442526 6:34061154-34061176 GAGCAGATGTGGCCCCTGCCAGG - Intronic
1006906067 6:37534554-37534576 GAGCAGGAACGGCCCCTGACTGG - Intergenic
1012390220 6:98729710-98729732 GAGTGGGGTCTGCCCCTGACAGG - Intergenic
1013007091 6:106083833-106083855 TATCAGAGGCTGCCACTGTCTGG - Intergenic
1013367312 6:109446010-109446032 GAGGAGAGGCTGCCACGGCCTGG + Intronic
1013455028 6:110322827-110322849 GAGCAGAGCCTGCCCAAGGCTGG + Exonic
1014303926 6:119716780-119716802 AAGCAGAGGGACCCCCTGACTGG + Intergenic
1016548957 6:145255590-145255612 GAGAAGAGTCTGTCCCTGGCCGG - Intergenic
1018909999 6:168096421-168096443 GGGCCCAGGCTGACCCTGACAGG + Intergenic
1019493149 7:1324398-1324420 GTGCAGAGGCTCCTCCTGAATGG + Intergenic
1019499190 7:1355884-1355906 GGGCAGGGGCTGCCCCAGAAGGG + Intergenic
1019628393 7:2033047-2033069 CAGCTGACGCTGCCACTGACTGG + Intronic
1019724431 7:2593333-2593355 GAGCAGAGGACGCCCCTGAGAGG - Intronic
1020210922 7:6157807-6157829 GAGCGCTGGCTGCCCCTGCCAGG + Intronic
1022592365 7:31676917-31676939 GAGCATAGGCAGCCACTGAGTGG - Intergenic
1023168784 7:37370098-37370120 GAGCAGAGGCGGAGGCTGACTGG - Intronic
1024203076 7:47126088-47126110 GAGGAGAGCCTGGCCCTGAGTGG - Intergenic
1024274484 7:47666924-47666946 CAGCACAGGCTTTCCCTGACTGG + Intergenic
1024700933 7:51903545-51903567 GAGCAGAGCCTGCCTGTGAATGG + Intergenic
1025170756 7:56754435-56754457 AAGCAGAGCCTGACCCTGGCAGG - Intergenic
1025701128 7:63821264-63821286 AAGCAGAGCCTGACCCTGGCAGG + Intergenic
1026224677 7:68429803-68429825 GAGGAGAGACTGCTCCTGGCTGG + Intergenic
1027193741 7:76013704-76013726 GAGCACAGGCAGGCCCAGACGGG - Intronic
1030126027 7:106153366-106153388 GAGGAGAAGCTGCCCCTCAGAGG + Intergenic
1033766000 7:144491264-144491286 AAGCAAAGGCAGCACCTGACAGG - Intronic
1034461836 7:151201983-151202005 CAGCAGAGGCTGACCCAGAGAGG + Intronic
1034699378 7:153083273-153083295 GAGCAGAGGCAGCTCCTCTCTGG - Intergenic
1035393944 7:158523524-158523546 GAGCAGAGTCTGCCCTGGAATGG + Intronic
1035393960 7:158523601-158523623 GAGCAGAGTCTGCCCTGGAGTGG + Intronic
1036789830 8:11710047-11710069 GAGTAAAGGCTACCCCTGCCAGG + Intronic
1036806009 8:11834275-11834297 AAGCAGAGGCTGCTCCAGAGTGG - Intronic
1038391812 8:27208879-27208901 TTGCAGAGGCTGCACCTGAGTGG + Intergenic
1038447570 8:27614654-27614676 GGGCACAGGGTGCCGCTGACCGG - Exonic
1043284898 8:78516342-78516364 GAGCGGAGGCTGCTGCTGGCAGG + Exonic
1043702973 8:83313431-83313453 CAGCAGAGGCTGCTCCAGATGGG + Intergenic
1044821384 8:96158234-96158256 GAACAGAGGCCTCCCCAGACTGG + Intronic
1045946797 8:107805418-107805440 GAGCAGCGGAAGCCCCAGACAGG - Intergenic
1048992740 8:139770871-139770893 GAACAAAGGCTGGCCCTGCCCGG + Intronic
1049285753 8:141774328-141774350 GAGCAGAGCCTTCCCCAGTCAGG - Intergenic
1049319343 8:141987713-141987735 CAGGAGAGGCTGCCCCTCCCAGG + Intergenic
1049619432 8:143591368-143591390 GAGCAGAGCGTGCCCCCGGCAGG - Intronic
1052817405 9:33112196-33112218 GAACAGAGGCTCCCTCTGCCTGG + Exonic
1053276699 9:36788586-36788608 GAGAAGAGGGAGCCCCTGGCAGG + Intergenic
1056724631 9:89103881-89103903 TACCAGAGGCTGCCTCTGTCAGG + Intronic
1060202781 9:121661431-121661453 GTTCAGAGGCTGCTCCTGATGGG - Intronic
1060395387 9:123312925-123312947 GAGCAGAGAATGCCTCTGGCAGG - Intergenic
1060756864 9:126219953-126219975 GAGCAGATGCTGACCCTGTGGGG - Intergenic
1061252244 9:129433111-129433133 GAGGAGAGGCAGCCCCTGCCAGG - Intergenic
1062412510 9:136432170-136432192 GAGCAGACGATGCCCATGGCAGG + Intronic
1062461608 9:136664738-136664760 GAGCAGCTCCTGCCCCTGTCCGG + Exonic
1062475509 9:136724897-136724919 GGGCAGCCGCTGCCCCTGCCTGG - Intergenic
1062622037 9:137427564-137427586 AAGGAGAGGCTGCCCCAGAGGGG - Intronic
1062656464 9:137606387-137606409 GAGGTGAGGCTGCCTCTGCCCGG + Intronic
1185479775 X:437723-437745 CAGCAGAGGCTGCGCGTGCCTGG - Intergenic
1190916469 X:54814810-54814832 GAGCATGGGGTGCCCCTGGCTGG + Intronic
1191863644 X:65686381-65686403 TACCAGAGGTTGACCCTGACTGG + Intronic
1198223229 X:134622084-134622106 GAGCAGATGCCTTCCCTGACTGG - Intronic
1199596410 X:149509618-149509640 GGGCAGAGCCTGCCCTTGAGGGG - Intronic
1202598680 Y:26570260-26570282 CATCAGAGGCTCCCCCTGCCTGG - Intergenic