ID: 932302472

View in Genome Browser
Species Human (GRCh38)
Location 2:70676906-70676928
Sequence AAGAGTGAGCTGGCTGTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 246}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932302472 Original CRISPR AAGAGTGAGCTGGCTGTTCA GGG Intronic
901061087 1:6472198-6472220 CAGAGTGAGCTGGCAGTGTAGGG - Intronic
901781307 1:11596604-11596626 GAGACAGAGCTGGCTTTTCAAGG - Intergenic
906130809 1:43454097-43454119 AAGAGAGAGCTGGCTGCCCGAGG + Intergenic
906481761 1:46203813-46203835 AAGAGTGAGTGGGGTGTTGATGG + Intronic
906866138 1:49422695-49422717 AAGAGTGAGCTGGGTGAAGAAGG - Intronic
907021543 1:51071300-51071322 ATGAGTGAGCTGGCCGTGGAAGG - Intergenic
907301232 1:53487521-53487543 AAGAGTGACCTGGCAGTGGAGGG + Intergenic
907408353 1:54267879-54267901 TAAAGAGAGCTGGCTGTGCAGGG - Intronic
908306538 1:62824945-62824967 AAGTGTGAGCTGGCTGGGCATGG + Intronic
909289597 1:73865836-73865858 CTGAGTGAGATGGCTGTTCTAGG - Intergenic
910840535 1:91556879-91556901 ATGTGTGAGCTGGGTCTTCAAGG + Intergenic
911054026 1:93695596-93695618 AAAATTGAGCAAGCTGTTCAGGG - Intronic
911480540 1:98434475-98434497 TAGAGTGAGGTAGCTGCTCACGG + Intergenic
912195481 1:107392418-107392440 GAGAGTGAGCTGGCTGTGCTAGG + Intronic
912415726 1:109507338-109507360 AAGAGAGGGCTGGCTGCCCAAGG - Exonic
912901627 1:113656705-113656727 AAGAATGATCTGGCTGGGCACGG - Intronic
917556295 1:176093416-176093438 AAAAGTGATCTGGCTGGGCATGG + Intronic
919361345 1:196599403-196599425 AACAGTGAACTGGTTGTTCCTGG - Intronic
921455178 1:215362718-215362740 AAGAGTGTTTTGGCTCTTCATGG + Intergenic
921661143 1:217804082-217804104 AAGATTGCTTTGGCTGTTCAGGG - Intronic
923589457 1:235306228-235306250 AAGATTGTGCTGGCTGGGCACGG + Intronic
924644014 1:245860281-245860303 AACAGTGAGCTGTCTGCTCAGGG - Intronic
1065146416 10:22772682-22772704 AAGTGGGAGCTGGCTGGGCAAGG - Intergenic
1066116000 10:32240689-32240711 AAGATTGTGTTGGCTATTCAGGG + Intergenic
1066477368 10:35761003-35761025 ATGAGTGAGCCAGCTGTACAGGG + Intergenic
1068993087 10:63171430-63171452 AAGAGTGGGCTGTCTGTTCAAGG - Intronic
1069909172 10:71749460-71749482 AAGAGGGTGCTGGCTGGCCATGG - Exonic
1070049543 10:72874062-72874084 AGGATTGCTCTGGCTGTTCAAGG + Intronic
1070377601 10:75848934-75848956 AATAGGAAGCTGGCTGGTCAAGG - Intronic
1074169144 10:110916025-110916047 TAGAGTGAGTAGGCTGTCCAAGG + Intronic
1074550216 10:114435796-114435818 AAGAGTGAGGGGTCTGTCCATGG - Intronic
1075026641 10:118989737-118989759 AAGATTGTTTTGGCTGTTCATGG - Intergenic
1075257568 10:120937844-120937866 AAGAGTCAGCTGGAGCTTCATGG - Intergenic
1076058342 10:127393499-127393521 AAGGCTGAGCAGGCTGTTAAGGG + Intronic
1077494298 11:2878924-2878946 AACAGTGAGTTGGGTCTTCAAGG + Intergenic
1077556780 11:3229855-3229877 AAGAGGGAGCTGTCTGATGATGG + Intronic
1078619218 11:12892296-12892318 AAGAGGGGGATGGCTGTGCATGG + Intronic
1081974079 11:47220174-47220196 AAGTGTGAGATGGGTGTTCAAGG + Intronic
1082641060 11:55662227-55662249 AAGATTGAACTGGAAGTTCAAGG + Intergenic
1085457520 11:76673433-76673455 AAGACTGAGCTGTCTGCTGATGG - Intergenic
1085732895 11:79014274-79014296 AAGAGGGAACTGGCTGTGCCTGG - Intronic
1085866878 11:80304585-80304607 AAGAGAGAGCTTGTTGTGCAGGG - Intergenic
1087004288 11:93453901-93453923 AAGAGAGAGCAGGCTTTTGATGG - Intergenic
1088282845 11:108153122-108153144 TAGAGTGCAGTGGCTGTTCATGG - Intergenic
1088372641 11:109108086-109108108 AAGAATGAGCTGGCTGGGCGCGG - Intergenic
1089952081 11:122537095-122537117 AAGAGGGAGCTGGCATCTCATGG - Intergenic
1090029576 11:123195397-123195419 AAGCGTGAGCTGGCCGGGCAGGG + Intergenic
1090857859 11:130625949-130625971 CACAGTGAGCTGGCTGGGCAAGG - Intergenic
1093084267 12:14849175-14849197 AAGAGTGAGCTACCTTTTTATGG + Intronic
1095818615 12:46452223-46452245 ATGAGTCAGCTTTCTGTTCACGG - Intergenic
1096592781 12:52672791-52672813 AAAAGGCAGCTGGCTGCTCAGGG - Intergenic
1096712150 12:53465259-53465281 AAAAGGGAGCTGGGTCTTCAGGG - Intronic
1098506458 12:71257341-71257363 AAGATTGAGTTGGCTATTCATGG - Intronic
1100344827 12:93718133-93718155 AACATTGAGTTGGCTGTTCTGGG + Intronic
1101093936 12:101316335-101316357 ATGAGTGAACATGCTGTTCACGG + Intronic
1103832721 12:123793148-123793170 CAGAGTGGCCTGGCTGTGCAAGG + Intronic
1104055257 12:125225175-125225197 AAAAGTGAGGTGGCTGCCCAGGG + Intronic
1104189410 12:126464599-126464621 AAGAGAGAGATGGCTGGTCACGG - Intergenic
1105206663 13:18231374-18231396 AATAGTGAGATGGCTCCTCATGG - Intergenic
1105350513 13:19610945-19610967 AAGATTGTGTTGGCTATTCAAGG + Intergenic
1106340047 13:28819605-28819627 AAGAATGAGTTGGCCGTTCCAGG - Intergenic
1106545778 13:30730266-30730288 AACCATGAGCTAGCTGTTCATGG + Intronic
1107470599 13:40687928-40687950 AAGACTAAGCTGGCTGTTCTGGG - Intergenic
1108651444 13:52484094-52484116 AAGGAAGAGCTGGCTGGTCAGGG - Intergenic
1108820283 13:54341208-54341230 TAGAGTGAGCTGCCTCTTCTGGG - Intergenic
1110391987 13:74984612-74984634 AAGAGGGAGCCGGCACTTCACGG + Intergenic
1110645180 13:77874599-77874621 AAGAGTTGGCAGGCTGCTCATGG - Intergenic
1111345421 13:86946970-86946992 AAGAGTGGGCTGCCTGTGAACGG + Intergenic
1113014873 13:105817649-105817671 AAGGCTGAGCTTGCTGTGCAAGG - Intergenic
1113295672 13:108956292-108956314 GAGAGAGAGCTGGCAGTACAAGG - Intronic
1113422931 13:110183987-110184009 AAGAATGTGCTGGCTGTTCTAGG - Intronic
1113772058 13:112916753-112916775 AGGCGTGAGCTGGTTGTTCGGGG - Intronic
1114965826 14:27957971-27957993 AAGAGAGCGCTGACTGTCCATGG - Intergenic
1116016151 14:39409539-39409561 AAGACTGCTCTGGCTATTCAGGG + Intronic
1116222055 14:42099642-42099664 AAGAGTGCTATGGCTGTTCTGGG - Intergenic
1117864495 14:60131731-60131753 AAGATTGTTCTGGCTATTCAGGG - Intronic
1119089062 14:71763419-71763441 AAGAGGAAACTGGCTGTGCAGGG - Intergenic
1119398935 14:74348995-74349017 AAGAGGGAGCTGGCAGGTCCGGG - Intronic
1119427893 14:74547664-74547686 AGGAGGGAGCTGGCTTTTCTAGG - Intronic
1120113458 14:80585312-80585334 ACCAGTGATCTGGCTGTTTAAGG + Intronic
1120623665 14:86797113-86797135 AAGAGAGATCAGGCTGTTCTCGG - Intergenic
1121195541 14:92068411-92068433 TAGAGAGAGCAGGCTTTTCATGG + Intronic
1121609460 14:95266720-95266742 AAGAGTGCGTTGGCTATTCAGGG - Intronic
1122972281 14:105157225-105157247 AGGAGCGGGCTGGCTGTGCAGGG - Intronic
1123736728 15:23191761-23191783 AAGAGTAAAGTGGCAGTTCAGGG + Intergenic
1124287429 15:28414736-28414758 AAGAGTAAAGTGGCAGTTCAGGG + Intergenic
1124287953 15:28420439-28420461 AAGAGTAAAGTGGCAGTTCAGGG + Intergenic
1124295273 15:28496888-28496910 AAGAGTAAAGTGGCAGTTCAGGG - Intergenic
1125858473 15:42974527-42974549 AATACTGAGCTGGCTATTCTAGG + Intronic
1127579641 15:60326278-60326300 GAGATTCAGCTGGTTGTTCACGG - Intergenic
1128242039 15:66107781-66107803 ATGAGTGGGCTGGCTTTTCCAGG - Intronic
1129063624 15:72881896-72881918 AAGAGTCAGCTGGCTGGGCATGG + Intergenic
1129309789 15:74698715-74698737 AATAGTGAGCTGGCTCTTCTAGG + Intergenic
1129382242 15:75175426-75175448 AAAAATTAGCTGGGTGTTCAAGG - Intergenic
1129592056 15:76924801-76924823 AAGATTGAGCTGGCTATTTTTGG + Intergenic
1134181108 16:12048508-12048530 AGGAGTGAGCAGCCTGTTCAGGG + Exonic
1134447911 16:14344664-14344686 AAGAGTGTGCTGGCTGTGCTTGG - Intergenic
1135279264 16:21139756-21139778 AAGAATGAGGTGGCTGGGCATGG - Intronic
1135279311 16:21140073-21140095 AAGAATGAGGTGGCTGGGCATGG - Intronic
1135307845 16:21382263-21382285 AGGAGTGAGCAGCGTGTTCAGGG + Intergenic
1135827153 16:25738898-25738920 AAGATTGACTTGGCTATTCAGGG + Intronic
1136304590 16:29361383-29361405 AGGAGTGAGCAGCGTGTTCAGGG + Intergenic
1136455435 16:30377540-30377562 TAGAGTGACCTGGGTTTTCAGGG + Intronic
1137319041 16:47359688-47359710 AACAGTAAGCTTGATGTTCAAGG - Intronic
1143303704 17:5929583-5929605 AAGAGGGATTTGGCTGTGCAAGG + Intronic
1143773889 17:9185490-9185512 CTGAGTGAGCTGGCCCTTCAAGG - Intronic
1144630441 17:16869424-16869446 AGGTGGGAGCTGGCTGTGCACGG - Intergenic
1144766344 17:17734888-17734910 GAGAGAGAGATGGCTGTTCTTGG - Intronic
1147671678 17:42180274-42180296 AGGAGTGATGTGGCTGTCCAAGG + Intronic
1148517571 17:48235102-48235124 AAGACTGAGCTGGGTTTTGAAGG + Intronic
1149383959 17:56123698-56123720 AAGAGAGACCTTGCTGCTCATGG + Intronic
1153336362 18:3929948-3929970 CAGAGTGATCTGGCAGTTCATGG - Intronic
1153793136 18:8597831-8597853 AAGAATGAGCTTTCTGTTCACGG + Intergenic
1155367482 18:25063292-25063314 AAGAGTTAGCTGGCTGATGATGG + Intronic
1157484696 18:48078529-48078551 AAGAGTGAGTTGGGTGTACTGGG + Intronic
1158162651 18:54502740-54502762 AAGAGGGAGCTGGCAGTTCCTGG + Intergenic
1159737275 18:72115221-72115243 CAGAGTGAACTGGCTTTTCATGG - Intergenic
1160210186 18:76871240-76871262 AAGTGAGAGTTGGCTGTCCAGGG + Intronic
1160389141 18:78517450-78517472 AGAAGTGAGCTGGCGGTTCCTGG + Intergenic
1161560836 19:4971659-4971681 AAGGGTGAGCTGGCTGCCCAGGG + Intronic
1165378920 19:35464030-35464052 AGGTGTGAGCTGGCTGGGCACGG - Intergenic
1165577510 19:36833950-36833972 AAGAGTGAATGGGCTGGTCATGG + Intronic
1165700380 19:37932847-37932869 AAGAGTGGGCCGGGTGTTGACGG + Intronic
925165281 2:1711772-1711794 CAGTGGGAGCTGGCTGTTTAGGG - Intronic
926130280 2:10298847-10298869 AAGATTGTTTTGGCTGTTCAGGG - Intergenic
926624648 2:15081023-15081045 AAGAGTCAGCTGCCTCTGCATGG - Intergenic
927049978 2:19318215-19318237 AAGATTGACCTAGCTATTCAAGG + Intergenic
928409664 2:31045080-31045102 AAGAATGACCAGGCTGCTCAGGG + Intronic
928800847 2:35089592-35089614 AAGATTGATTTGGCTATTCAGGG - Intergenic
929895163 2:45953452-45953474 GAGCGGTAGCTGGCTGTTCAGGG - Intronic
930293480 2:49525260-49525282 AAGAGTGACCTGCCTGTTATTGG - Intergenic
930408687 2:50996066-50996088 AAGAGTGAGCAGGTTCTGCAAGG + Intronic
930773574 2:55151324-55151346 AACCGTGAGCTGGTTGTTCAAGG + Intergenic
931193455 2:60027734-60027756 AAGAGAGATGAGGCTGTTCATGG - Intergenic
931620561 2:64205755-64205777 GGGAGTGACCTGGCTGTTCCTGG + Intergenic
932302472 2:70676906-70676928 AAGAGTGAGCTGGCTGTTCAGGG + Intronic
932821217 2:74902632-74902654 AAGAGTAATCTGGTAGTTCAGGG - Intergenic
935603360 2:104945364-104945386 GAAACTGAGCTGGCTGTTCCTGG - Intergenic
936340026 2:111623033-111623055 AGGAGTGAGCTCCCTGTTCCTGG - Intergenic
937015214 2:118598917-118598939 AGGAGTAGCCTGGCTGTTCATGG - Intergenic
937074075 2:119088373-119088395 GAGAGTGAGCTGGAAGATCACGG - Intergenic
940467348 2:154048020-154048042 ATGATTCAGCAGGCTGTTCAGGG + Intronic
940504214 2:154532177-154532199 AAGACTTAGCTGTTTGTTCAAGG - Intergenic
940820047 2:158343056-158343078 TAGAGTGCAGTGGCTGTTCACGG + Intronic
940998079 2:160171864-160171886 ATGACTGAACTGGCTTTTCAAGG + Intronic
942311912 2:174664084-174664106 AAGGGTGTGCTGGCTGGTGAGGG - Intronic
942327511 2:174788378-174788400 AAGGGTCAGATGTCTGTTCAAGG - Intergenic
945390000 2:209253673-209253695 AAGAGAGAGCTGGCTTCTTAGGG - Intergenic
947626169 2:231620401-231620423 AACAGTGATCTGGGAGTTCAGGG - Intergenic
948327945 2:237141468-237141490 AAGAGTGAACTGGCTGGTGTAGG + Intergenic
948610130 2:239161746-239161768 CTGGGTGAGCTGGGTGTTCAAGG - Intronic
948637560 2:239349177-239349199 AAGAGTGAGCCGGGTGGGCAGGG + Intronic
1169043793 20:2519323-2519345 GAGAGTGAGCTGGAGGTACAGGG - Intronic
1170977363 20:21178040-21178062 AAGATTGTCTTGGCTGTTCAGGG + Intronic
1171387999 20:24783083-24783105 AAGAGGGAGCAGGATGTTCTGGG - Intergenic
1172459453 20:35105635-35105657 AGGTGTGAGCTGGCTGGGCATGG + Intergenic
1172767339 20:37357894-37357916 AGGAGTGTGCTGGCTTTTCAGGG + Intronic
1173143180 20:40502632-40502654 CAGAGTGAGCGGGCTGTGCTGGG - Intergenic
1175328826 20:58148672-58148694 ATGAGTGAGTTGGGTTTTCAAGG - Intergenic
1178427346 21:32489561-32489583 AAGATTGCTTTGGCTGTTCATGG + Intronic
1178686130 21:34712101-34712123 TAGAGTGAGATTGCAGTTCATGG + Intronic
1178723999 21:35035273-35035295 AAGGGTGAGTAGCCTGTTCAAGG + Intronic
1179417951 21:41213482-41213504 ATGAGTAAGCTGGCTGGGCACGG + Intronic
1179554171 21:42162161-42162183 CAGATTCAGATGGCTGTTCAGGG + Intergenic
1179805527 21:43834812-43834834 AGGAGGGAGCTGGCTGGGCAGGG + Intergenic
1180759281 22:18187330-18187352 AATAGTGAGATGGCTCCTCATGG + Intergenic
1180769589 22:18371626-18371648 AATAGTGAGATGGCTCCTCATGG + Intergenic
1180776739 22:18491040-18491062 AATAGTGAGATGGCTCCTCATGG - Intergenic
1180809466 22:18748406-18748428 AATAGTGAGATGGCTCCTCATGG - Intergenic
1180827529 22:18874589-18874611 AATAGTGAGATGGCTCCTCATGG + Intergenic
1181072387 22:20353392-20353414 AATAGTGAGATGGCTCCTCATGG - Intronic
1181195458 22:21182326-21182348 AATAGTGAGATGGCTCCTCATGG - Intergenic
1181213989 22:21310448-21310470 AATAGTGAGATGGCTCCTCATGG + Intergenic
1181524435 22:23472081-23472103 AATAGTGAGATGGCTCCTCATGG + Intergenic
1181914401 22:26268042-26268064 AACAATGGGCTGGCTTTTCAGGG + Intronic
1182932926 22:34192083-34192105 AAGTGTGGGCTGGGTGGTCAGGG + Intergenic
1184113991 22:42411504-42411526 AAGGGTGACCTGGCAGTCCAGGG + Exonic
1184501692 22:44878615-44878637 CAGGGTGGGCTGGCTGTCCAGGG - Intergenic
1185235121 22:49707850-49707872 AAGAGTGTGTTGGCTGCGCATGG - Intergenic
1203231420 22_KI270731v1_random:112813-112835 AATAGTGAGATGGCTCCTCATGG + Intergenic
1203277626 22_KI270734v1_random:100579-100601 AATAGTGAGATGGCTCCTCATGG + Intergenic
949273012 3:2242627-2242649 AAGATTGAACTGACTATTCAAGG - Intronic
950102306 3:10365421-10365443 GAGAGTGAGGTGGCTGTGCAGGG + Intronic
951374232 3:21893374-21893396 AAGAATAAGCTGTCTGTGCAAGG - Intronic
953106280 3:39883241-39883263 AAGAGTGAACTGGATGTGGAAGG + Intronic
953223586 3:40997223-40997245 AAGAGTGAGGTGGCTCTACAAGG + Intergenic
954744476 3:52779274-52779296 ATGTGTTAGCTGGCTGGTCAGGG - Intronic
954920911 3:54190099-54190121 AGGAATGAGCTAGCTCTTCAGGG + Intronic
959330316 3:104996696-104996718 AAAAGTGAGCTGGCATTTCATGG + Intergenic
961915898 3:130374741-130374763 AAAATTAAGCTGGCTGGTCATGG - Intronic
962489458 3:135878421-135878443 AAGATTGATCTGGCCATTCATGG - Intergenic
964646266 3:158961314-158961336 AGTAGTGAGGTGGCTGTTCTTGG - Intergenic
964955651 3:162352842-162352864 AAGCGTGAGCTGAGAGTTCAAGG - Intergenic
965841888 3:172915580-172915602 AACAGTGTGCTGCCTGTTCAAGG - Intronic
970573432 4:17404843-17404865 AACAGGGAGCTGGCTGGTTAAGG - Intergenic
976131159 4:81885340-81885362 AACAGTGCGCTGGCTGCTGAAGG - Intronic
977526486 4:98152224-98152246 AAGAGAGAGCTGGCCGTGCACGG - Intergenic
978989451 4:115061205-115061227 GAGAGTGAGCTGATTTTTCAAGG + Intronic
980424374 4:132607667-132607689 AAGACTTGGCTGTCTGTTCATGG - Intergenic
986039946 5:3983694-3983716 AAGAGAGAGCTGCCTGTTCCTGG + Intergenic
986659553 5:10046743-10046765 ATGAGTGAGCTGGATCTTGAAGG + Intergenic
988500531 5:31780024-31780046 AAAAGTGAGCTTGCTTCTCAGGG - Intronic
990035608 5:51314799-51314821 AATATTGAGCTGGCTATTCTGGG + Intergenic
991098105 5:62760956-62760978 AAGCTTGAGCAGGCTGGTCATGG + Intergenic
991589143 5:68230891-68230913 AAGAGTGTGCTGGGTGTGCAAGG + Intronic
991667268 5:69011684-69011706 AACAGTGAGCTGCCTATTCCAGG + Intergenic
992634888 5:78717860-78717882 AAGAGTCAGCTGGCTGTCACCGG - Intronic
993239837 5:85368495-85368517 AAAACTGAGCTGCCAGTTCAAGG + Intergenic
994454629 5:99989004-99989026 AAGACTGAAATGGATGTTCAAGG - Intergenic
994646362 5:102474106-102474128 CAGATTGATTTGGCTGTTCAGGG - Intronic
994816931 5:104596704-104596726 AAGAGTTAGCTTGCTGCACAAGG - Intergenic
997572251 5:134939855-134939877 AAGAGAGGGCTGGTTTTTCATGG - Intronic
998137937 5:139684237-139684259 AAGGCTGAGCTGCCTGTTCAGGG + Intergenic
1000566513 5:162854768-162854790 AAGAGGGAGCTCTGTGTTCATGG - Intergenic
1002685396 5:181005453-181005475 AAGAGTGTGGTGGCTTCTCAGGG + Exonic
1005578355 6:27210874-27210896 AAGAGTGAACAGGCTGGGCACGG + Intergenic
1006142929 6:31941796-31941818 AAAAGTGAACTGGCTGGGCATGG - Intronic
1006685489 6:35829661-35829683 AAAAGTGAGATGGGTTTTCAGGG - Intronic
1007224014 6:40300264-40300286 GACAGTGAGCAGGCTGTCCAAGG + Intergenic
1010972262 6:82275492-82275514 AGGAGGGAGCAGGCTGCTCATGG - Intergenic
1011735578 6:90307506-90307528 AAGACTGAATTGGCTATTCAAGG + Intergenic
1012821687 6:104092348-104092370 AGGATTGAGTTGGCTGATCAAGG - Intergenic
1013197792 6:107860827-107860849 AAGATTGTTTTGGCTGTTCAGGG + Intergenic
1013571860 6:111435340-111435362 AAGATTGATTTGGCTATTCAGGG - Intronic
1014172410 6:118293065-118293087 GAGGGTGTGCTGGCTTTTCAAGG + Intronic
1014287660 6:119518948-119518970 GGCAGTGACCTGGCTGTTCATGG + Intergenic
1014809384 6:125868899-125868921 AGGAGAGAGCTGGTCGTTCATGG + Intronic
1015032370 6:128610595-128610617 AAGATTGTTCTGGCTATTCAGGG + Intergenic
1015996308 6:138998511-138998533 AAGAGTTGGCTGGTTGGTCAGGG + Intergenic
1016285887 6:142472730-142472752 AAGATTGATTTGGCTATTCATGG - Intergenic
1016676424 6:146775062-146775084 AAAAGTAAGCTGGCTGAGCATGG - Intronic
1017014167 6:150086421-150086443 AACAGTCAACTGGCTGTTCCAGG - Intergenic
1017395913 6:153999949-153999971 AAGAGAGAGCTGGGTGTCCCTGG - Intergenic
1017432987 6:154389552-154389574 AAGATTGATATGGCTATTCATGG + Exonic
1017703224 6:157096062-157096084 AAGAGTGGGATGGATGTTCCAGG - Intronic
1019102864 6:169646269-169646291 GAGAGTGAGGCTGCTGTTCAAGG + Intronic
1021541848 7:21768453-21768475 AACAGTGAGCTGTCTGGTGAAGG + Intronic
1023520111 7:41041376-41041398 AAGACTGACCTGGCTGGGCATGG - Intergenic
1023916361 7:44592281-44592303 AAGAATGAGGTGGATGGTCATGG + Intergenic
1024285038 7:47749814-47749836 GAGAGTGGGCTCGCTGGTCAGGG + Intronic
1025139621 7:56451160-56451182 GAGAGTGAGCTGGCTGTCAATGG + Intergenic
1025239453 7:57258887-57258909 GAGAGTGAGCTGGCTGTCAATGG + Intergenic
1026052365 7:66958116-66958138 CGGAGTGCGCTTGCTGTTCAGGG + Exonic
1027206579 7:76105166-76105188 AAGAGTGAACTGGCCGGGCATGG + Intergenic
1027521986 7:79220693-79220715 TAGAGTGAGGTGACTGTTCCAGG - Intronic
1028487249 7:91373506-91373528 AAGAGTGGGCTGACTGGTCAAGG + Intergenic
1029533422 7:101140757-101140779 AGAAATGAGCTGGGTGTTCAGGG - Intergenic
1031864087 7:127018471-127018493 AAGTGTAAGCAGGCAGTTCAGGG + Intronic
1032458839 7:132094376-132094398 AAGAGGGAGCTGGAGGCTCAAGG - Intergenic
1034871441 7:154688122-154688144 AAGAGTGTCCTGGCTGTCCTTGG + Intronic
1035209780 7:157319199-157319221 AAGAGAGAGATGGCTGGGCATGG + Intergenic
1036778515 8:11629884-11629906 GAGAGGGAGCTGGCTGATCAGGG + Intergenic
1036796820 8:11762187-11762209 AGAAGTGAGCTGGCAGTGCACGG - Exonic
1037730734 8:21521409-21521431 AATAGAGAGGTGGCTTTTCAGGG - Intergenic
1039444817 8:37622551-37622573 AAGAGTGTGTTGTGTGTTCAGGG - Intergenic
1039613613 8:38937897-38937919 GCGTGTGGGCTGGCTGTTCAGGG + Intronic
1039998212 8:42553691-42553713 AAGAGTGAGCTGGCTGGGCACGG + Exonic
1040400364 8:47044094-47044116 ATCAGTGAGCAGGCTCTTCAAGG - Intergenic
1040792636 8:51250658-51250680 AAGAGTGAGCTGGCAGGGCATGG - Intergenic
1041388762 8:57330670-57330692 AAGAGTGAGTAGGCTGACCAAGG - Intergenic
1041762838 8:61385299-61385321 AAGTGTGATATGGCTGTCCAGGG + Intronic
1044021617 8:87112148-87112170 AAGAGTGAGCAGGCAGATGATGG - Intronic
1048409765 8:134160691-134160713 CAGAGTGTGCTGGCTGTTTGGGG + Intergenic
1048976442 8:139675476-139675498 AAGAGTGAGCTGGCTTTCTGGGG - Intronic
1051562431 9:18456780-18456802 CAGATTGAGGTGGCTGTTCAGGG - Intergenic
1052996870 9:34555822-34555844 AAGAGGGAGATGCCTGGTCAGGG + Intronic
1055042469 9:71889968-71889990 AAGACTGAGCGGGCTGGGCAAGG + Intronic
1055939687 9:81637566-81637588 GACAGTGAGCTGTTTGTTCAGGG - Intronic
1056360927 9:85856779-85856801 AAGAGAGAGCTGGCCGAGCACGG + Intergenic
1058191637 9:101923848-101923870 CAGAGAGAACTGGCTGTTCCTGG - Intergenic
1060667380 9:125439933-125439955 AAGAGTGAGCGGGCTTTTGAGGG + Intronic
1061394340 9:130335473-130335495 AAGACTGAGCAAACTGTTCAGGG + Intronic
1061731618 9:132619022-132619044 AGGAGTGAGTGGGCTGTTCCAGG + Intronic
1203787423 EBV:135729-135751 CAGAGGGAGCTGGCTCTTGACGG - Intergenic
1186158419 X:6750451-6750473 AACAGTGAACTGCCTCTTCAGGG - Intergenic
1189238227 X:39505345-39505367 AGGAGTGAGCTGGTTGAGCAGGG - Intergenic
1190254566 X:48752913-48752935 AGCAGTGAGCTGGCTGATCAAGG - Intergenic
1190854914 X:54284678-54284700 AAGAATGAGCTGGCTGGGCATGG + Intronic
1193912875 X:87327369-87327391 AAGGGTGAGGTGGCTGTGCTGGG - Intergenic
1195560367 X:106276341-106276363 AATAGGGAGCTGGGTGGTCAAGG - Intergenic
1195561595 X:106289998-106290020 AATAGGGAGCTGGGTGGTCAAGG + Intergenic
1196125152 X:112089715-112089737 AAGATTGTTTTGGCTGTTCAGGG + Intergenic
1197162211 X:123336778-123336800 AAAGGTGAGGTGGCTGTGCAAGG - Intronic
1197896176 X:131318046-131318068 GAGAGAGAGCTGGCTCTTCATGG - Intronic
1199219228 X:145297623-145297645 AAGACAGAGCTGGGAGTTCAAGG + Intergenic
1199835055 X:151581811-151581833 TTGACAGAGCTGGCTGTTCATGG - Intronic
1200162613 X:154017150-154017172 GAGAGTGAAGTGGCTGTTCCAGG - Intronic
1202025475 Y:20518303-20518325 AAGAGTGCTCTGGCTGTAGAGGG - Intergenic