ID: 932304473

View in Genome Browser
Species Human (GRCh38)
Location 2:70692115-70692137
Sequence GCCCCACGCCTTGGTCCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 61}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932304462_932304473 24 Left 932304462 2:70692068-70692090 CCTCTGTCAAGATATCTCCTTGC 0: 1
1: 0
2: 0
3: 4
4: 131
Right 932304473 2:70692115-70692137 GCCCCACGCCTTGGTCCAACAGG 0: 1
1: 0
2: 0
3: 7
4: 61
932304471_932304473 -4 Left 932304471 2:70692096-70692118 CCTGGCTTCGTGGGGGCAGGCCC 0: 1
1: 0
2: 0
3: 16
4: 239
Right 932304473 2:70692115-70692137 GCCCCACGCCTTGGTCCAACAGG 0: 1
1: 0
2: 0
3: 7
4: 61
932304469_932304473 2 Left 932304469 2:70692090-70692112 CCAGAGCCTGGCTTCGTGGGGGC 0: 1
1: 0
2: 2
3: 17
4: 252
Right 932304473 2:70692115-70692137 GCCCCACGCCTTGGTCCAACAGG 0: 1
1: 0
2: 0
3: 7
4: 61
932304464_932304473 7 Left 932304464 2:70692085-70692107 CCTTGCCAGAGCCTGGCTTCGTG 0: 1
1: 0
2: 2
3: 25
4: 206
Right 932304473 2:70692115-70692137 GCCCCACGCCTTGGTCCAACAGG 0: 1
1: 0
2: 0
3: 7
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932304473 Original CRISPR GCCCCACGCCTTGGTCCAAC AGG Intronic
900786418 1:4653344-4653366 GCCCCAAGCCATGGTCCTCCTGG + Intergenic
901070222 1:6513280-6513302 ACCCCAAGGCTTGGTCCAGCTGG + Intronic
903942680 1:26942491-26942513 CCCCCAAGCCTTGGTCCACTGGG - Intronic
905662570 1:39738782-39738804 CACCCTCGCGTTGGTCCAACCGG - Intronic
905695399 1:39969760-39969782 GCCCCAGGGCTTGGCCCCACAGG - Exonic
907303169 1:53500713-53500735 GCCCCAGGCCTGGGTGCAACAGG - Intergenic
908772481 1:67609469-67609491 GCCCCAAGCCATGGCCCAACAGG - Intergenic
915891938 1:159781190-159781212 GCCGCACGCCCAGGTCCAACAGG - Exonic
916028496 1:160855961-160855983 GCCCCACACCTTCCTCCGACTGG - Intronic
1067237097 10:44460185-44460207 ACCCCACTCCTTGGTCCTACTGG - Intergenic
1071907927 10:90195639-90195661 GCCCCACGCTTTGTTCTGACTGG + Intergenic
1075684230 10:124353023-124353045 ACCCCAGGCGTTGGGCCAACAGG - Intergenic
1076181686 10:128414284-128414306 ACTCCACGCTTTGGTCAAACTGG - Intergenic
1076438979 10:130466448-130466470 GGCCCACGCCCTGGTGCAGCTGG - Intergenic
1076785693 10:132748853-132748875 GCCCCTCTCCTTGGTCCTCCTGG + Intronic
1082001625 11:47396186-47396208 GCCCCAGGCCCTGGGCCACCTGG - Intergenic
1100376495 12:94020840-94020862 GCTCCAGGCCCTGTTCCAACAGG - Intergenic
1103414870 12:120737236-120737258 GTCACAGGCCTTGGTCCTACTGG + Intronic
1107169417 13:37322115-37322137 AACCCACTCCTTGGTACAACTGG - Intergenic
1113890861 13:113734958-113734980 GCCCCAGGCCTTTGTGCATCTGG + Intronic
1118576938 14:67251846-67251868 GCCCCATGCCTTGGTCTTTCTGG - Intronic
1132761903 16:1512657-1512679 GCACCGCGCCCTGCTCCAACGGG - Intronic
1136412284 16:30084536-30084558 GCCCCATGCTCTGGTCCCACGGG + Intronic
1139477113 16:67208303-67208325 GCCCCACACCTTGGCTAAACTGG + Exonic
1152299326 17:79486028-79486050 GCCCCACCCCTTGGTGCTGCGGG + Intronic
1152563753 17:81091126-81091148 GCCCCACCCCTTGGTGCAGGAGG + Intronic
1152584134 17:81181599-81181621 GCTCCACGCCTCGGGCCAGCTGG + Intergenic
1152706222 17:81844989-81845011 GCCCCACACCTTCGCCCAGCAGG - Intronic
1152740791 17:82017490-82017512 GGCCCACACCATGGTCCACCAGG - Intergenic
1157244604 18:46042034-46042056 GCCCCAGGCCTGGGTCCTGCTGG - Intronic
1163111331 19:15162438-15162460 GCCCCAGCCCTTGGTCCACTGGG - Intronic
1163428996 19:17255606-17255628 TCCCCTCTCCTTGGTCCCACAGG - Exonic
1164703705 19:30304081-30304103 GCACCAGGCCTGAGTCCAACCGG - Intronic
1165461118 19:35944953-35944975 GGCCCACACCGTGGTCCAGCTGG + Exonic
1166783834 19:45356144-45356166 GCCCCAGGCCCTGGGCCAGCCGG + Intronic
1167323886 19:48812515-48812537 GCCCCCCCCCTGGGTCCAGCTGG + Intergenic
1168020797 19:53607246-53607268 GCCCCACTCCTGTGTCCAAGAGG + Intergenic
1168687665 19:58358245-58358267 ACCCCATGCCTTGGACCACCTGG - Intronic
926163583 2:10504607-10504629 GGCCCATGCCTGGGTCCCACCGG - Intergenic
929999286 2:46850066-46850088 GCCTGACCCCTTGGTCCAGCCGG + Intronic
932304473 2:70692115-70692137 GCCCCACGCCTTGGTCCAACAGG + Intronic
938115763 2:128602138-128602160 GCCCCACGCCCTGGTGCCACAGG + Intergenic
940777811 2:157902940-157902962 CACCCACTCCTTGGTGCAACTGG - Intronic
948800900 2:240433102-240433124 CCCCCACGCCCTGGCCCAACAGG + Intergenic
1173785719 20:45791717-45791739 TCCCCAGGCCTTGGCCCAGCGGG + Intronic
1175927307 20:62477177-62477199 CCACCACGCCTGGGTCCACCCGG - Intergenic
1177246079 21:18525953-18525975 GCCCCACTCCTTGCACCAAACGG + Intergenic
1179446996 21:41438931-41438953 GCCCCTTGCCATGGTCCAGCTGG - Intronic
1180168272 21:46041306-46041328 GCCCCAGCCCCTGGTCCCACTGG - Intergenic
1183676048 22:39299454-39299476 GCCCCATCCCTTGGTCCCACTGG + Intergenic
1185000363 22:48241790-48241812 GGCCCACGCCTTGCTCCATGAGG - Intergenic
950579367 3:13852506-13852528 GACCCACTCCTTGTTCCGACCGG - Intronic
954906225 3:54065362-54065384 ACCCCACGCCTGGGACAAACAGG - Intergenic
956727077 3:72164877-72164899 TGCCCACGCCTTGGTCTACCAGG - Intergenic
967685116 3:192409337-192409359 GCTCCCCGCCATGGTCCACCCGG + Intronic
969329478 4:6465213-6465235 TCCCCACCCCTTGGTCCTGCGGG + Intronic
1002292405 5:178208991-178209013 GCACCACACCTTGGTCCTGCTGG - Intronic
1008507840 6:52247844-52247866 GCCCCACATCTGTGTCCAACTGG + Intergenic
1012532041 6:100249932-100249954 TCCCCACTCCTTTCTCCAACTGG + Intergenic
1018424254 6:163666062-163666084 GCCCCGCCCCATGGTCCTACTGG + Intergenic
1043175476 8:77019064-77019086 GCTCCAAGCCTTAGTCCAGCTGG - Intergenic
1043378531 8:79677733-79677755 GCCCTACATCTTGATCCAACTGG - Intergenic
1045003780 8:97900295-97900317 GCCCCAGCTCTTGGTCCATCTGG - Intronic
1047222374 8:122928761-122928783 GCCTCACACCCTGGGCCAACGGG + Intronic
1049675723 8:143888036-143888058 GCTCCACCCCTTGCTCCAAGGGG - Intergenic
1052095668 9:24380861-24380883 CACCTATGCCTTGGTCCAACTGG + Intergenic
1060111926 9:120912721-120912743 GCCACAGTTCTTGGTCCAACAGG - Intronic
1062419543 9:136473213-136473235 GCCCCAAGTCTGGTTCCAACTGG + Intronic
1196857114 X:119994818-119994840 GCCCCACGCCTTAGTTCTTCTGG + Intergenic